![logo](https://static.igem.org/mediawiki/2021/e/ef/T--BUCT--BUCTlogo8.png)
Also, this year the BUCT team chose MazEF TA system as a suicide element, presenting "basic" and "oxygen-altering death" circuits that act as a kill switch for E. coli.
Express antitoxin mazE (BBa_K302032)under the control of the phyb promoter, which is only on under microaerophilic conditions.
The expression of the toxin mazF (BBa_K823044) is induced by dietary lactose. Under microaerophilic conditions in the human intestine, engineered bacteria will survive by expressing the antitoxin MazE. However, once bacteria are excreted to the aerobic environment, MazE will no longer be produced, causing bacteria to commit suicide.
To test the function of the toxin, mazF will be controlled under an inducible promoter.
Also, this time we construct a plasmid (BBa_K3875007) to produce GABA with the consumption of the simple carbon sources. By doing this, we supplement all paths of producing GABA from simple carbon sources to the production GABA. This is an improvement for (BBa_K2326005), which just produced GABA from middle step.
Basic parts |
Name |
Type |
Description |
Designer |
Length |
BBa_K3875000 |
Coding |
gadB-E89Q+△452-466 |
Yimiao Lin |
1356 |
|
BBa_K3875001 |
Coding |
AntrpC |
Yimiao Lin |
2310 |
|
BBa_K3875003 |
Coding |
trpG |
Yimiao Lin |
615 |
|
BBa_K3875004 |
Coding |
p4h(W179F) |
Yimiao Lin |
891 |
|
BBa_K3875005 |
Coding |
pcd |
Yimiao Lin |
357 |
|
BBa_K3875008 |
Coding |
gdhA |
Yimiao Lin |
1344 |
|
BBa_K3875009 |
Coding |
trpE |
Yimiao Lin |
1563 |
|
BBa_K3875015 |
Coding |
AmpR |
Yimiao Lin |
861 |
|
BBa_K3875016 |
Coding |
pUC18-LYF |
Yimiao Lin |
934 |
|
BBa_K3875018 |
Teminator |
Teminator |
Yimiao Lin |
32 |
|
BBa_K3875019 |
Regulatory |
J23119(SpeI) promoter |
Yimiao Lin |
35 |
|
BBa_K3875020 |
RNA |
gRNA trageting fadR |
Yimiao Lin |
20 |
|
BBa_K3875021 |
Conjugatiom |
Cas9 binding |
Yimiao Lin |
34 |
|
BBa_K3875023 |
RNA |
sgRNA-R |
Yimiao Lin |
25 |
|
BBa_K3875026 |
Composite |
Lac-mazF-T1-lac-phyb-mazE-T1 |
Yimiao Lin |
1064 |
|
BBa_K3875027 |
Composite |
Lac-mazF-T1-lac-vgb-mazE-T1 |
Yimiao Lin |
1005 |
|
BBa_K3875028 |
RBS |
aggaga |
Yimiao Lin |
6 |
|
BBa_K3875029 |
RBS |
aacaattgaaattattcctc |
Yimiao Lin |
21 |
Composite parts |
Name |
Type |
Description |
Designer |
Length |
BBa_K3875001 |
Composite |
Lac-fadL-fadD-T1 |
Yimiao Lin |
3412 |
|
BBa_K3875006 |
Composite |
Lac-trpE-trpG-AntrpC-T1 |
Yimiao Lin |
4672 |
|
BBa_K3875007 |
Composite |
Lac-gadB(mut)-gdhA-T1 |
Yimiao Lin |
2835 |
|
BBa_K3875010 |
Composite |
Lac-trpB-p4h-pcd-T1 |
Yimiao Lin |
2603 |
|
BBa_K3875011 |
Composite |
Lac-trpE-trpG-AntrpC-T1-lac-trpB-p4h-pcd-T1 |
Yimiao Lin |
7266 |
|
BBa_K3875013 |
Composite |
Lac-mazF-T1 |
Yimiao Lin |
486 |
|
BBa_K3875014 |
Composite |
T7-gaB(mut) |
Yimiao Lin |
1385 |
|
BBa_K3875017 |
Composite |
AmpR promoter-AmpR-pUC18-LYF-Teminator |
Yimiao Lin |
1956 |
|
BBa_K3875022 |
Composite |
J23119 promoter-gRNA targeting fadR-Cas9 binding-Teminsator |
Yimiao Lin |
145 |
|
BBa_K3875030 |
Composite |
Phyb-mazE-T1 |
Yimiao Lin |
530 |
Improved parts |
Part Number |
Type |
Description |
New Part Number |
New Description |
BBa_K3100017 |
Coding |
Wild gadB |
BBa_K3875000 |
gadB-E89Q+△452-466 |
|
BBa_K2326005 |
Coding |
LacI - pTac - gadA + 6xHis Tag - Terminator
|
BBa_K3875007 |
Lac-gadB(mut)-gdhA-T1 |
Characterized parts |
Part Number |
Type |
Description |
BBa_K3040118 |
Coding |
fadD |
|
BBa_K3040117 |
Coding |
fadL |
|
BBa_K823044 |
Coding |
mazF |
|
BBa_K302032 |
Coding |
mazE |
[1] Chae, T. U., Ko, Y. S., Hwang, K. S., & Lee, S. Y. (2017). Metabolic engineering of Escherichia coli for the production of four-, five- and six-carbon lactams. Metabolic engineering, 41, 82–91. https://doi.org/10.1016/j.ymben.2017.04.001
[2] Sheng, L., Shen, D., Yang, W., Zhang, M., Zeng, Y., Xu, J., Deng, X., & Cheng, Y. (2017). GABA Pathway Rate-Limit Citrate Degradation in Postharvest Citrus Fruit Evidence from HB Pumelo (Citrus grandis) × Fairchild (Citrus reticulata) Hybrid Population. Journal of agricultural and food chemistry, 65(8), 1669–1676. https://doi.org/10.1021/acs.jafc.6b05237