Team:BUCT/Parts

• Home
• Team
  • Team members
  • Attributions
  • Collaborations
  • Partnership
• Project
  • Description
  • Engineering Success
  • Results
  • Implementation
  • Contribution
  • Improvement
• Dry Lab
  • Model
• Wet Lab
  • Safety
  • Notebook
  • Experiments
  • Design
• Parts
  • Parts
• Human Practices
  • Integrated Human Practice
  • Communication
  • Education
• Excellence

• Overview
• gadB(mut)
• Characterization
• Improved Part
• Basic parts
• Composite parts
• Improved parts
• Characterized parts

Parts

Overview

In the part of producing GABA, we redesigned the gadB of 2019_SCUT (BBa_K3100017) and characterized its the activity of GadB in different pH value. We have also characterized our new part, gadB-E89Q+z452-466 (BBa_K3875000) from E.coli. The results of the two parts are compared. It is indicated that GabB transcribed by our mutated gene (gadB-E89Q+z452-466) is active in a wide range of pH, while GadB transcribe by wild gene is only active at pH 4.6.

gadB(mut)

There are many E.coli glutamate decarboxylase isoforms, and GadB is one of them. Glucose and Acetyl-CoA can be consumed in the citric acid cycle to form ɑ-ketoglutaricacid, which can produce L-glutamate under the catalyst of gdhA, L-glutamate can be future turned into GABA(4-aminobutyricacid) under the catalyst of L-glutamate decarboxylase (GadB) ^[1]. Concerning that the wild-type GadB has an optimal activity at pH 4.5, which is not a suitable condition for cell growth, we want to mutate gadB to a mutant gene (gadB E89Q Δ452-466). Then the GadB transcribed by our gene gadB(mut) will be active in a wide range of pH, so as to overproduce GABA ^[2].

Characterization

we linked the sequence of fadD (BBa_K3040118) and fadL (BBa_K3040117) into pCS27 backbone, which contains lac operator so that FadD and FadL can be induced by IPTG. The plasmids were tranferred into E.coli 1917 Nissle strain and we induced the recombinant overnight. The expression of the fusion protein was determined by SDS-PAGE.
Also, this year the BUCT team chose MazEF TA system as a suicide element, presenting "basic" and "oxygen-altering death" circuits that act as a kill switch for E. coli.

Express antitoxin mazE (BBa_K302032)under the control of the phyb promoter, which is only on under microaerophilic conditions.

The expression of the toxin mazF (BBa_K823044) is induced by dietary lactose. Under microaerophilic conditions in the human intestine, engineered bacteria will survive by expressing the antitoxin MazE. However, once bacteria are excreted to the aerobic environment, MazE will no longer be produced, causing bacteria to commit suicide.

To test the function of the toxin, mazF will be controlled under an inducible promoter.

Improved Part

In improvement, we mutated the gene gadB of 2019_SCUT (BBa_K3100017) and tried to characterize GadB and GadB(mut) in different pH value. Then results of the two parts are compared.
Also, this time we construct a plasmid (BBa_K3875007) to produce GABA with the consumption of the simple carbon sources. By doing this, we supplement all paths of producing GABA from simple carbon sources to the production GABA. This is an improvement for (BBa_K2326005), which just produced GABA from middle step.

Basic parts

Basic parts	Name	Type	Description	Designer	Length
	BBa_K3875000	Coding	gadB-E89Q+△452-466	Yimiao Lin	1356
	BBa_K3875001	Coding	AntrpC	Yimiao Lin	2310
	BBa_K3875003	Coding	trpG	Yimiao Lin	615
	BBa_K3875004	Coding	p4h(W179F)	Yimiao Lin	891
	BBa_K3875005	Coding	pcd	Yimiao Lin	357
	BBa_K3875008	Coding	gdhA	Yimiao Lin	1344
	BBa_K3875009	Coding	trpE	Yimiao Lin	1563
	BBa_K3875015	Coding	AmpR	Yimiao Lin	861
	BBa_K3875016	Coding	pUC18-LYF	Yimiao Lin	934
	BBa_K3875018	Teminator	Teminator	Yimiao Lin	32
	BBa_K3875019	Regulatory	J23119(SpeI) promoter	Yimiao Lin	35
	BBa_K3875020	RNA	gRNA trageting fadR	Yimiao Lin	20
	BBa_K3875021	Conjugatiom	Cas9 binding	Yimiao Lin	34
	BBa_K3875023	RNA	sgRNA-R	Yimiao Lin	25
	BBa_K3875026	Composite	Lac-mazF-T1-lac-phyb-mazE-T1	Yimiao Lin	1064
	BBa_K3875027	Composite	Lac-mazF-T1-lac-vgb-mazE-T1	Yimiao Lin	1005
	BBa_K3875028	RBS	aggaga	Yimiao Lin	6
	BBa_K3875029	RBS	aacaattgaaattattcctc	Yimiao Lin	21

Composite parts

Composite parts	Name	Type	Description	Designer	Length
	BBa_K3875001	Composite	Lac-fadL-fadD-T1	Yimiao Lin	3412
	BBa_K3875006	Composite	Lac-trpE-trpG-AntrpC-T1	Yimiao Lin	4672
	BBa_K3875007	Composite	Lac-gadB(mut)-gdhA-T1	Yimiao Lin	2835
	BBa_K3875010	Composite	Lac-trpB-p4h-pcd-T1	Yimiao Lin	2603
	BBa_K3875011	Composite	Lac-trpE-trpG-AntrpC-T1-lac-trpB-p4h-pcd-T1	Yimiao Lin	7266
	BBa_K3875013	Composite	Lac-mazF-T1	Yimiao Lin	486
	BBa_K3875014	Composite	T7-gaB(mut)	Yimiao Lin	1385
	BBa_K3875017	Composite	AmpR promoter-AmpR-pUC18-LYF-Teminator	Yimiao Lin	1956
	BBa_K3875022	Composite	J23119 promoter-gRNA targeting fadR-Cas9 binding-Teminsator	Yimiao Lin	145
	BBa_K3875030	Composite	Phyb-mazE-T1	Yimiao Lin	530

Improved parts

Improved parts	Part Number	Type	Description	New Part Number	New Description
	BBa_K3100017	Coding	Wild gadB	BBa_K3875000	gadB-E89Q+△452-466
	BBa_K2326005	Coding	LacI - pTac - gadA + 6xHis Tag - Terminator	BBa_K3875007	Lac-gadB(mut)-gdhA-T1

Characterized parts

Characterized parts	Part Number	Type	Description
	BBa_K3040118	Coding	fadD
	BBa_K3040117	Coding	fadL
	BBa_K823044	Coding	mazF
	BBa_K302032	Coding	mazE

Reference

[1] Chae, T. U., Ko, Y. S., Hwang, K. S., & Lee, S. Y. (2017). Metabolic engineering of Escherichia coli for the production of four-, five- and six-carbon lactams. Metabolic engineering, 41, 82–91. https://doi.org/10.1016/j.ymben.2017.04.001

[2] Sheng, L., Shen, D., Yang, W., Zhang, M., Zeng, Y., Xu, J., Deng, X., & Cheng, Y. (2017). GABA Pathway Rate-Limit Citrate Degradation in Postharvest Citrus Fruit Evidence from HB Pumelo (Citrus grandis) × Fairchild (Citrus reticulata) Hybrid Population. Journal of agricultural and food chemistry, 65(8), 1669–1676. https://doi.org/10.1021/acs.jafc.6b05237

The whole BUCT team would like to thank our sponsors. Especially:

                               

Tel: 86+18718806286

Address: No.15 North Third Ring East Road,Chaoyang District,Beijing,P.R.China. Beijing University of Chemical Technology

BUCT--iGEM

BUCT--iGEM