Team:BUCT/Improvement

• Home
• Team
  • Team members
  • Attributions
  • Collaborations
  • Partnership
• Project
  • Description
  • Engineering Success
  • Results
  • Implementation
  • Contribution
  • Improvement
• Dry Lab
  • Model
• Wet Lab
  • Safety
  • Notebook
  • Experiments
  • Design
• Parts
  • Parts
• Human Practices
  • Integrated Human Practice
  • Communication
  • Education
• Excellence

• Part for BBa_K3100017
• Design
• Construction
• Testing
• Reference

Part for BBa_K3100017

In improvement, we mutated the gene gadB of 2019_SCUT ( BBa_K3100017) and tried to characterize GadB and GadB(mut) in different pH value. Then results of the two parts were compared.

Design

Firstly, we selected the gene gadB-E89Q+z452-466 ( BBa_K3875000) and gdhA ( BBa_K3875008), and used the promoter pLlacO ( BBa_R0011) to promote them and terminator BBa_B0015 to terminate the procedure[1]. After that, the entire sequence ( BBa_K3875007) was introduced into pCS27 and yielded the recombinant plasmid pCS-lac-gadB(mut)-lac-gdhA-T1.

Bellows are pictures of our plasmid.

Figure. 1 The plasmid profile of lac-gadB(mut)-T1-lac-gdhA-T1

Figure. 2 Skeleton map of lac-gadB(mut)-gdhA

Construction

lac-gadB(mut)-gdhA was obtained by PCR amplification. pCS- lac-gadB(mut)-gdhA and a had the same cohesive end by restriction endonuclease, and then they were connected by T1 ligase. Finally, the linked plasmid was transformed into E. coli DH5a.

In order to detect the expression of recombinant gene, the plasmid containing pCS-lac-gadB(mut)-gdhA was transformed into E. coli DH5α. for fermentation.

Testing

We tried to verify whether the plasmid was successfully constructed. It demonstrated the success of plasmid construction.

Below is the result of fermentation and it shows that we have successfully produced GABA from simple carbon sources.

GABA was produced by fermentation with glycerol as substrate:

GABA was produced by fermentation with palm oil as substrate:

GABA was produced by fermentation with soybean oil as substrate”

Secondly, we design the experiment below to prove that we have improved part ( BBa_K3100017).
We first communicate with the leader of 2019_SCUT team to get their plasmid profile which they used to produce GadB in 2019.

Based on this plasmid, we construct a new plasmid (BBa_K3875014), which just introduce the gene gadB(mut) into pET-30a(+)-gadB to replace the gene gadB.

For the pET30-gadB, we decide to remove the gene gadB from E.coli B.W25113,and then going PCR amplification. After PCR amplification, pET30-gadB and a had the same cohesive end by restriction endonuclease, and then they were connected by T7 ligase. Finally, the linked plasmid was transformed into E. coli DH5a. Then we plan to run a gel to make sure that the gene is a right one. After that, in order to detect the expression of recombinant gene, the plasmid containing pET30-gadB was transformed into E. coli DH5a for fermentation (In fact, we didn't do all of these because of time constraints).

After fermentation, we extract and purify the GadB and examine its activity in different value. And based on a variety of dissertations and the experiments done by 2019_SCUT team, the result may be that GadB only maintain active in pH 4.5[2,3,4].

For the pET30-gadB(mut), because we had successfully constructed the composite part (Lac-gadB(mut)-lac-gdhA-T1/BBa_K3875007), so we can directly remove the gene gadB(mut) from Lac-gadB(mut)-lac-gdhA-T1 (BBa_K3875007) with Primer 1 (CTTGAGACCTCCTTCTTAAAGTTAAAC) and Primer 3 (CAAGGGGTTATGCTAGTTATTGCTCTTAGTGATCGCTGAGATATTTCAGG).

After PCR amplification, pET30-gadB(mut) and a had the same cohesive end by restriction endonuclease, and then they were connected by T7 ligase. Finally, the linked plasmid was transformed into E. coli DH5a.

After the Polymerase Chain Reaction, the gene run a gel.

As we can see from this picture, number 9,13,15 is the proper gadB(mut) that we need.

In order to detect the expression of recombinant gene, the plasmid containing pET30-gadB(mut) was transformed into E. coli DH5a for fermentation (In fact, we didn't do it because of time constraints).
After that, we plan to purify the protein GadB (mut) and detect the protein activity of GadB in different pH value.
Our assumption is that our GadB (mut) would remain active at different pH, instead of just being active in pH 4.5.

Below is a map of our design for this experiment:

Reference

[1] Sheng, L., Shen, D., Yang, W., Zhang, M., Zeng, Y., Xu, J., Deng, X., & Cheng, Y. (2017). GABA Pathway Rate-Limit Citrate Degradation in Postharvest Citrus Fruit Evidence from HB Pumelo (Citrus grandis) × Fairchild (Citrus reticulata) Hybrid Population. Journal of agricultural and food chemistry, 65(8), 1669–1676.https://doi.org/10.1021/acs.jafc.6b05237
[2] Gut, H., Pennacchietti, E., John, R. A., Bossa, F., Capitani, G., De Biase, D., & Grütter, M. G. (2006). Escherichia coli acid resistance: pH-sensing, activation by chloride and autoinhibition in GadB. The EMBO journal, 25(11), 2643–2651.https://doi.org/10.1038/sj.emboj.7601107
[3] Chae, T. U., Ko, Y. S., Hwang, K. S., & Lee, S. Y. (2017). Metabolic engineering of Escherichia coli for the production of four-, five- and six-carbon lactams. Metabolic engineering, 41, 82–91.https://doi.org/10.1016/j.ymben.2017.04.001