Team:Tsinghua/Safety

• 
• HOME
• TEAM ▼
  • Members
  • Attributions
• PROJECT ▼
  • Description
  • Design
  • Pro-Lac
  • Mucosal Healing
  • Microbiota Regulation
  • Metabolic Balancing
  • Delivery
  • Proof of Concept
  • Engineering
• SAFETY
• EXPERIMENT ▼
  • Parts
  • Protocol
  • Lab Notebook
• MODELING ▼
  • Main Page
  • LAP Adhesion
  • Simulator
  • Lateral Flow
  • Protein Degradation
• SOFTWARE ▼
  • P2N
  • gDesign
• HP ▼
  • Human Practices
  • Collaborations
  • Partnership
• AWARD ▼
  • Contribution
  • Medal Criteria
  • Education
  • Communication
  • Implementation

Safety

Safety

• Target AID
• In vivo validation
  • The animal welfare
  • Necessity of experiment
  • In vivo safety test
  • Result
  • Conclusion

Safety has always been the first priority of our team. Apart from ensuring our own safety in laboratory by taking every necessary safety protections (like wearing lab coats and gloves) and consulting with our advisors before conducting experiments, we need to make sure the material we use will not cause harm to the environment. Since most reagents and laboratory waste are collected and processed by the School of Life Science, Tsinghua University, the major safety concern stems from the engineered bacteria and materials that we proposed to be administrated into living creature.

To be more specific, we realized that safety issues could exist in two dimensions. Firstly, we need to consider the environmental risks of our strains when released to the environment to comply with the green development concept and requirement. To achieve this, we designed our strains to be auxotroph so that they are unable to live outside the intestinal tract. In this way, even environmental release happens, the engineered strains will not cause much harm to the environment. Please check out our Target-AID system to see our efforts in this direction.

Secondly, although we have taken every possible steps to ensure the safety and non-toxicity of our delivery reagents and engineered strains, we need animal experiments to prove its safety inside living creature to make future clinical trials possible. Please check out our in vivo validation for more information.

Target AID

As we have stated, our project is about engineering E. coli and L.lactis to fight against IBD. Although our engineered strains are highly unlikely to cause any environmental harm, we considered to further guarantee the biosafety of our strains by introducing auxotroph. This means the engineered strains will be unable to grow outside the intestinal tract of patients, and therefore even in very rare cases of environmental release, they will not grow in the environment to cause any risk.

To achieve this, we chose carbonic anhydrase gene in bacteria as the target gene. Carbonic anhydrase catalyzes the conversion of carbon dioxide (CO2) into bicarbonate ion, a crucial ion that is essential to the survival of bacteria. We noticed that the concentration of bicarbonate ion inside the intestinal tract is high enough to support the growth of bacteria even without carbonic anhydrase, whereas outside the intestinal tract this gene is needed to generate bicarbonate ion for the survival of the bacteria. Therefore, by constructing a strain that has carbonic anhydrase deficiency, we can guarantee that the bacteria can only survive inside the intestinal tract as it should.

We first considered using CRISPR-Cas to deactivate the carbonic anhydrase gene. However, the limitations of using CRISPR-Cas system in prokaryotic cells (e.g., high lethality rate) made us think about other possible routes. We then came to another gene editing technic called “Target-AID” that have been developed for gene editing in E. coli^[1].

In Target-AID system(Fig.1), a cytidine deaminase called pmCDA1 is fused to catalytically dead Cas9 (dCas9) to form a fusion protein. The fusion protein will be guided to the desired gene loci under the guidance of designed sgRNA. Instead of creating double-strand break (DSB) at DNA target sites as what Cas9 does, the dCas9 part of dCas9-pmCDA1 only binds to the DNA and catalyzes the conversion of cytosine to uracil through deamination. This C-to-U editing will replace the previous amino acid-encoding codon with a stop codon, and the protein will not be synthesized normally as a result. In this way, we can achieve the loss-of-function editing of carbonic anhydrase gene.

Fig.1 Principle of Target AID

This system is convenient and more efficient than CRISPR-Cas9 system in E. coli, and has been used widely in laboratories that work on E. coli gene editing. We noticed that the design of sgRNA is crucial to the success of this system, which is usually achieved manually and therefore requires experience in CRISPR-related fields. To make this system easier and friendlier for potential users who might lack enough experience, we designed a software that can help the design of sgRNA based on the principles of Target-AID system. Please check out the details in our software pages
We had designed 5 pairs of gRNA as followed：
1.(95) CGCAAAAACCGCGCTTTCTA (114)
2. (311) TACAAGCCGCAGTTGAAAACC (331)
3.(491) TGCAATCAGCGTGGAAACGC (510)
4.(512) GGCAGAAAGTTACCATTCACGGC (534)
5.(506) TTCCACGCTGATTGCATAATGG (485) -antisense sequence

However, we didn't get the mutation as we expected. Carbonic anhydrase-deficient mutants can only survive with enough supplement of bicarbonate radical ion. In previous work, carbonic anhydrase-deficient mutants were cultured in bacteria incubator with 5% CO2^[2]. Unfortunately, our lab isn't equipped with the bacteria incubator, so we tried to add extra NaHCO3 in LB as compensation. Originally, our bacteria contained two kinds of plasmids, as is shown in Fig.2.

Fig.2 Two kinds of Plasmids

But after culture in medium containing NaHCO3, we found that our bacteria had lost the dCas9 plasmid(anti-streptomycin), which meant that streptomycin lost its activation(Fig.3).

Fig.3 Only sgRNA plasmid

We speculated that the change of pH in LB containing NaHCO3 might have caused the inactivitation of streptomycin. We have not come up with other feasible plans to culture carbonic anhydrase-deficient mutant without a cell incubator.^[3]

In summary, we have used Target AID system to avoid potential environment risk of our engineered bacteria by introducing a stop codon inside the encoding region of carbonic anhydrase to ensure that the bacteria are unable to survive outside the intestinal tract. It is noteworthy that our approach is a general strategy that is not limited to carbonic anhydrase. Instead, we have found many proteins that can serve as the editing target here to construct the auxotroph(Table.1). We chose carbonic anhydrase as an example for proof-of-concept and we envision that future iGEM team can use the same or similar strategy to tackle biosafety issues when using engineered bacteria.

Table 1. List of Candidate Auxotroph Genes

In vivo validation

The animal welfare

The experiments were carried out in strict accordance with animal welfare regulations and the "3R" principle (Replacement, Reduction and Refinement) formulated by Chinese Association for Laboratory Animal Sciences. All the operations and designs have been approved by Institutional Animal Care and Use Committee (IACUC) of Tsinghua University (AP: 21-CGQ4). The mice were taken good care of by the teachers in Laboratory Animal Resources Center, Tsinghua University. The operation including weighing, fecal occult blood detecting, and intragastric administration were performed properly and brought as less disturbance as possible. When dissection, the euthanasia was applied by neck dislocation, and the corpse was also well managed properly by laboratory animal research center.

The necessity of in vivo experiment on mice

As the engineered EcN strain has been proven to successfully express the TFF therapeutic proteins, the in vivo test should be performed to further confirm its therapeutic effect. And since the animal experiment must comply with animal ethics, the safety of the engineered bacteria together with the operation or regents applied on animals should be guaranteed, which is also the precondition of the subsequent experiments testing the cure effect of the bacteria.

The experimental process of the in vivo safety test

The process of the experiment is shown below (figure 1). The mice were divided into 5 groups, and the normal saline (negative control group #1), EcN bacterial containing GFP gene (blank control group #2), EcN bacterial containing TFF3 gene (TFF3 non-treated experimental group #3), chitosan coated EcN bacterial containing TFF3 gene (TFF3 treated experimental group #4) and salazosulfapyridine (positive control group #5) were delivered into the intestinal of different groups of the mice by intragastric administration on day 1,3,5.

To monitor the growth of the mice, the weight was measured every day as an index representing the mice healthy condition. Then the fecal occult blood and the length of the colon were detected on day 10 to prove that the bacterial has no significant influence on intestinal health.

Fig.4 The process of in vivo safety test experiment

Result

The normalized weight of the 5 mice groups of the (figure 2) shows little fluctuations during the whole period of the experiment. And there is no large variation after each time of intragastric administrations. Also The differences between experimental groups and normal saline control isare are not significant. These preliminary results indicate that the engineered bacterial and the reagents together with the intragastric administration protocol itself will not bring any harm to the mice.

Fig.5 The monitoring of the micebody weight changes of the mice

As the target of the engineered bacteria delivery is colon, the health condition of the colon was further monitored by measuring the length of colon and the fecal occult blood, which are the two important indexes in the diagnosis of bowel disease. It came out that most of the mice fecal occult blood measured by FOB kit (Baso, Zhuhai, China) gave negative results and only few of them showed a weak signal ( of only a single ‘+’ (table 1)). Such positive signals are within the margin of error and may be caused by the blood contamination when anatomy.

Tab.1 The fecal occult blood measurement of mice

(Severity is classified as -, +, ++, +++ and ++++ (most severe))

Then the colon length of each group was measured (figure 3). We observed that the colon lengths among all the groups were similar by comparing the mean value of each group (figure 4). Also the ANOVA also shows no significant difference between each experimental group and the control group with a high P value (Table 2). Hence, the bacteria and reagents delivered into the mice will neither affect the intestinal health nor induce a bowel disease.

Fig.6 The measurement of colon length

Fig.7 The colon length of each group

Conclusion

By detecting multiple healthy indexes of the mice, the engineered bacterial and the protocol on mice have been proved to be harmless and will not cause a bowel disease. This meets the requirement of biosafety as well as the animal ethics, and is also the prerequisite of the following in vivo therapeutic trials.

Reference

[1] Banno, S., Nishida, K., Arazoe, T., Mitsunobu, H., & Kondo, A. (2018). Deaminase-mediated multiplex genome editing in Escherichia coli. Nature microbiology, 3(4), 423–429.
[2]  Hashimoto M, Kato J. Indispensability of the Escherichia coli carbonic anhydrases YadF and CynT in cell proliferation at a low CO2 partial pressure. Biosci Biotechnol Biochem. 2003 Apr;67(4):919-22. doi: 10.1271/bbb.67.919. PMID: 12784642.
[3] https://pubchem.ncbi.nlm.nih.gov/compound/streptomycin#section=Collision-Cross-Section

Ref. for Table 1.:
1. Wright, O., Delmans, M., Stan, G. B., & Ellis, T. (2015). GeneGuard: A modular plasmid system designed for biosafety. ACS synthetic biology, 4(3), 307–316. https://doi.org/10.1021/sb500234s
2. Acord, J., & Masters, M. (2004). Expression from the Escherichia coli dapA promoter is regulated by intracellular levels of diaminopimelic acid. FEMS microbiology letters, 235(1), 131–137. https://doi.org/10.1016/j.femsle.2004.04.022
3. Minton, N. P., Ehsaan, M., Humphreys, C. M., Little, G. T., Baker, J., Henstra, A. M., Liew, F., Kelly, M. L., Sheng, L., Schwarz, K., & Zhang, Y. (2016). A roadmap for gene system development in Clostridium. Anaerobe, 41, 104–112. https://doi.org/10.1016/j.anaerobe.2016.05.011
4. Dodds, D., Bose, J. L., Deng, M. D., Dubé, G. R., Grossman, T. H., Kaiser, A., Kulkarni, K., Leger, R., Mootien-Boyd, S., Munivar, A., Oh, J., Pestrak, M., Rajpura, K., Tikhonov, A. P., Turecek, T., & Whitfill, T. (2020). Controlling the Growth of the Skin Commensal Staphylococcus epidermidis Using d-Alanine Auxotrophy. mSphere, 5(3), e00360-20. https://doi.org/10.1128/mSphere.00360-20
5. Burgess, C. M., Smid, E. J., Rutten, G., & van Sinderen, D. (2006). A general method for selection of riboflavin-overproducing food grade micro-organisms. Microbial cell factories, 5, 24. https://doi.org/10.1186/1475-2859-5-24
6. Capozzi, V., Russo, P., Dueñas, M. T., López, P., & Spano, G. (2012). Lactic acid bacteria producing B-group vitamins: a great potential for functional cereals products. Applied microbiology and biotechnology, 96(6), 1383–1394. https://doi.org/10.1007/s00253-012-4440-2
7. Sharma, V., Rodionov, D. A., Leyn, S. A., Tran, D., Iablokov, S. N., Ding, H., Peterson, D. A., Osterman, A. L., & Peterson, S. N. (2019). B-Vitamin Sharing Promotes Stability of Gut Microbial Communities. Frontiers in microbiology, 10, 1485. https://doi.org/10.3389/fmicb.2019.01485

Copyright © 2021 iGEM Team: Tsinghua. All rights reserved.