Team:Korea HS/Parts
KORHS
Basic information: Buforins, which house a helix-hinge-helix domain, kill a microorganism by entering the cell without membrane permeabilization and thus binding to nucleic acids. The proline hinge is crucial for the cell-penetrating activity of buforins. Buforins are also known to possess anti-endotoxin and anticancer activities, thus making these peptides attractive reagents for pharmaceutical applications. We modified the buforin IIb peptide sequence to induce cancer cell death by delivering doxorubicin and siRNA.
Buforin IIb modification: Amino acid sequence modification
- ▪ Buforin IIB: RAGLQFPVGRLLRRLLRRLLR (21 aa) (charge = +7)
- ▪ Modified Version 1 (MV1): RAGLQFPVGRLLRRLLR (17 aa) (charge = +5)
- ▪ Modified Version 2 (MV2): RAGLQFPVGRLLR (13 aa) (charge = +3)
Further modification: FITC was added to the c-terminal of the peptide to analyze the intracellular distribution in cancer cells. Doxorubicin was added to the c-terminal of the peptide to analyze the drug sensitivity of doxorubicin (chemotherapy drug).
The goal of this project:
- 1. Which peptide version has low cell cytotoxicity? MV1-FITC and MV2-FITC
- 2. Which peptide can specifically target cancer cells without harming normal cells? MV1-FITC
- 3. Can MV1 form a complex with siRNA targeting CYP1A1? Yes (MV1-FITC)
- 4. Which is more efficient in inducing cancer cell death? MV1-Doxorubicin with siRNA
Basic information: We modified the Buforin IIB sequence (-RLLR) MV1 peptide sequence: RAGLQFPVGRLLRRLLR (17 aa), net charge (+5). This peptide was designed specifically to target cancer cells to deliver drugs and siRNA.
Basic information: MV2 peptide sequence: RAGLQFPVGRLLR (13 aa) net charge (+3). We used this peptide to deliver siRNA into lung cancer cells to induce cell death.
Basic information: Small interfering RNA (siRNA) is sometimes known as short interfering RNA or silencing RNA. It is a class of double-stranded RNA non-coding RNA molecules, typically 20-27 base pairs in length, similar to miRNA and operating within the RNA interference (RNAi) pathway. It interferes with the expression of specific genes with complementary nucleotide sequences by degrading mRNA after transcription, preventing translation. siRNA targeting CYP1A1 was designed to induce the drug sensitivity of doxorubicin in cancer cells.
Structure: Naturally occurring siRNAs have a well-defined structure that is a short (usually 20 to 24-bp) double-stranded RNA (dsRNA) with phosphorylated 5' ends and hydroxylated 3' ends with two overhanging nucleotides. The Dicer enzyme catalyzes the production of siRNAs from long dsRNAs and small hairpin RNAs.[2] siRNAs can also be introduced into cells by transfection. Since in principle, any gene can be knocked down by a synthetic siRNA with a complementary sequence, siRNAs are an important tool for validating gene function and drug targeting in the post-genomic era.
siRNA sequence: GCUAGGGUUAGGAGGUCCU AGGACCUCCUAACCCUAGC
Basic information: CYP1A1 encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases that catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids, and other lipids. This protein localizes to the endoplasmic reticulum and its expression is induced by some polycyclic aromatic hydrocarbons (PAHs), some of which are found in cigarette smoke. The enzyme's endogenous substrate is unknown. However, it is able to metabolize some PAHs to carcinogenic intermediates. The gene has been associated with lung cancer risk. Previous reports showed that CYP1A1 is upregulated in doxorubicin-resistant cells.
Primer Sequence: CACCCTCATCAGTAATGGTCAGA R: AACGTGCTTATCAGGACCTCA
Note: Documentation to “Improvement of an Existing Part” was not included herein.