Line 227: | Line 227: | ||
</center> | </center> | ||
<p> | <p> | ||
− | To enable pH-sensitive property of HR2 aptamer, a DNA strand has to be added to the original aptamer which would fold into different shapes, which inhibits HR2 aptamer under high pH and allows high affinity for HER2 receptor under low pH. However, the pH-sensitive extension would extend the aptamer to 145 bp, which exceeds the limit for chemical synthesis, and even if we managed to reduce the length, the price of synthesis would remain expensive. Thus, we performed asymmetric PCR<sup>[3]</sup> to synthesize ssDNA strand. | + | To enable the pH-sensitive property of HR2 aptamer, a DNA strand has to be added to the original aptamer which would fold into different shapes, which inhibits HR2 aptamer under high pH and allows high affinity for HER2 receptor under low pH. However, the pH-sensitive extension would extend the aptamer to 145 bp, which exceeds the limit for chemical synthesis, and even if we managed to reduce the length, the price of synthesis would remain expensive. Thus, we performed asymmetric PCR<sup>[3]</sup> to synthesize ssDNA strand. |
</p> | </p> | ||
<p> | <p> |
Revision as of 15:00, 21 October 2021
Results
Overview
Our results mainly consist of 4 parts:
1. Binding affinity of aptamer
· ELONA lab for testing the binding affinity of the aptamer
· Asymmetric PCR for the synthesis of ssDNA
2. Preparation of Liposome nanoparticle
3. Preparation of PLGA nanoparticle
4. In vitro cytotoxicity assays
Aptamer
ELONA Experiment
The specificity part of our project relies on the specific binding between the aptamer and HER2 receptors. Obtaining quantitative results through our experiment would, first, allow us to know more information about the aptamer we are using, which helps us to better design later experiments. Secondly, we can use the data in our modeling to improve our design, such as the density of aptamer on the surface of nanoparticles. We tried out 2 types of aptamers (Nickname: H2[1] & HR2[2]) and synthesized these aptamers at Genscript. However, only HR2 aptamer yielded results. The result for H2 is presented in Supplement, as it did not aid out project.
HR2 Aptamer sequence:
5' -
AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTATA
TGTATTTGGTTTTTGGCTCTCACAGACACACTACACACGCACA
- 3'
We designed our experiment based on a sandwich ELISA kit which is an in vitro enzyme-linked immunosorbent assay for the quantitative measurement of human HER2 in serum, plasma, and cell culture supernatants. Our assay employs a well-plate with an antibody specific for human HER2 receptors coated on a 48/96-well plate. Recombinant Human HER2 standard is pipetted into the wells and is bound by the immobilized antibody. The wells are washed and a biotinylated HR2 aptamers antibody is added. After washing away unbound biotinylated HR2 aptamer, HRP-conjugated streptavidin is pipetted to the wells. The wells are again washed, a TMB substrate solution is added to the wells and color develops in proportion to the amount of HR2 aptamer bound. The Stopping Solution changes the color from blue to yellow, and the intensity of the color is measured at 450 nm.
We evaluated the ELISA kit first, with the standard sample given. The results indicated that, when the concentration of coated HER2 protein was at 8ng/mL, it still has reactivity to the provided HRP-antibody conjugates (provided in the kit) with high effectiveness and sensitivity. Thus, we chose to use add 8ng/mL of Recombinant Human HER2 standard.
First, we did a qualitative test for HR2 aptamer.We successfully measured the HR2 aptamer bind to HER2 protein with high specificity and sensitivity.
The result gave us insight into the range of concentration we should choose for obtaining the exact Kd of the aptamer in the followed-up quantitative experiment.
Next, we evaluated the HER2 binding affinity of the aptamer quantitively. In order to improve the efficiency of the experiment, we modified the experimental process. Firstly, we further reduced the HER2 protein concentration used in the experiment to 4ng/mL. Secondly, we replaced biotinylated HR2 aptamer with FAM-labeled aptamer for convenience, because FAM can be detected sensitively and we can reduce the process at the same time. HER2 proteins were incubated with increasing concentrations of FAM-labeled aptamer and analyzed by spectrofluorometer. Using non-linear regression analysis, the Kd of the aptamer for binding with the HER2 protein was estimated to be 1.803 μM.
Asymmetric PCR
After obtaining the binding affinity of HR2 Aptamer, we went on to design a pH-sensitive HR2 aptamer. Tumor cells up-regulate H+/Na+ antiporters and have produce excessive amounts of lactate, which results in reducing their environmental pH[4]. Allowing aptamers to be pH-sensitive, and only binds to HER2 receptors when they are in a low pH environment could minimize the damage dealt to normal tissue cells.
To enable the pH-sensitive property of HR2 aptamer, a DNA strand has to be added to the original aptamer which would fold into different shapes, which inhibits HR2 aptamer under high pH and allows high affinity for HER2 receptor under low pH. However, the pH-sensitive extension would extend the aptamer to 145 bp, which exceeds the limit for chemical synthesis, and even if we managed to reduce the length, the price of synthesis would remain expensive. Thus, we performed asymmetric PCR[3] to synthesize ssDNA strand.
First, we designed primers to synthesize the template; PCR has been carried out to replicate the template using the Forward Template and Reverse Template(shown below), where they would overlap and allow the replication of 145bp long template. Then, asymmetric PCR(asPCR) is performed, forward and reverse primer ratio of 1:1 up to 100:1 is added respectively in different groups to synthesize ssDNA strands.
Asymmetric PCR differs from normal PCR in the system used. In asymmetric PCR, forward and reverse primers are added with different ratios. So, ssDNA strands will be produced as there will be more forward (or backward) strands than the other.
pH-sensitive HR2 sequence, composed of HR2 Aptamer, pH-sensitive DNA switch, and complementary strand:
5' -
AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTATA
TGTATTTGGTTTTTGGCTCTCACAGACACACTACACACGCACA
TTTTGAGGGAAAGAATCATTTCTT
TCCCTATGTTTCCCTTTCTTTTTAA
TTGGGCGGTT
- 3'
Primer | 5‘ to 3' Sequence |
---|---|
Forward Template | AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTA TATGTATTTGGTTTTTGGCTCTCACAGACACACTACACACGC |
Forward Primer | AACCGCCCAAATCCCTAAGAG |
Reverse Template | AACCGCCCAATTAAAAAGAAAGGGAAACATAGGGAAAGAAA TGATTCTTTCCCTCAAAATGTGCGTGTGTAGTGTGTCTGTGAG |
Reverse Primer | AACCGCCCAATTAAAAAGAAAGGG |
Figure 1.5 is our result for asymmetric, as can be seen, an extra band of DNA appeared above the dsDNA band, which can be identified as ssDNA. We noticed that this is not concordant with our referenced literature[3], as in the literature ssDNA ends up below the dsDNA bands. However, we were able to prove the validity of our experiment by repeating with ssDNA strands synthesized by Genscript, which was used previously in ELONA (Figure 1.6). The ssDNA strand is 86bp long, however, it lies above the 100bp long ladder band. Through this, we can be sure of our result that we have synthesized the ssDNA strand of the desired length, though, due to unknown reasons, its band appeared above dsDNA strands.
Through asPCR, we were able to synthesize ssDNA strands which are our aptamers. Our next step is to buy FAM-modified primers to synthesize aptamers for the ELONA test of the pHs-HR2 aptamer. However, due to a lack of time and effort, we were unable to finish future experiments. Our original plan includes a qualitative test for the affinity of our pH sensitive aptamer at 5 μM, under pH 6.5, 7.1 and 8.0 to verify our theory. Our expected result would be an decrease in affinity when changing from pH 6.5 to 8.0.
Liposome
Manufacturing of Dox-encapsulated Liposome
We used microfluidics technology, which is on a specific automatic machinery, to manufacture liposomes using 2 different molar ratio of DSPC : cholesterol : PEG (DCP ratio), which is DSPC : cholesterol : PEG = 10 : 6 : 1 or 15 : 6 : 1 of materials at the first time, and also trying different rotate speeds (Fluid Velocity / mL*min-1): 6, 12, 18. Then we used Malvern Particle Sizer to measure the diameters of liposomes. A detailed protocol can be found in here.
Table 2.2 demonstrated that both DCP ratio and rotate speeds are important factors of liposome's diameter. Generally, liposomes with DCP ratio of 15 : 6 : 1 have larger diameters than 10 : 6 : 1 liposomes, while liposomes with rotate speed of 6 mL/min and 12 mL/min have smaller diameters. The Pdi of most sets are smaller than 0.3, which indicated that the sizes of liposomes are uniform. To meet our requirements of "150--200nm" to best coordinate with EPR effect, we decided only to use the speed 6mL/min the next time.
To better improve the size and stability of liposomes, we set another 2 DCP ratios (LA, 10 : 6 : 1.5 and LC, 15 : 6 : 1.5) for manufacturing. Due to the need of blank liposomes for conjugation testing which will be described in the latter part, we also made blank liposomes with four different ratios the second time. However, due to various reasons, the liposomes' sizes were bigger than the last time, though the results verified that a DCP ration of 10 : 6 : 1 is the best ratio for making suitable liposomes, which is also shown in our first experiment. Possible reasons can be the misoperation of staff, incoherence of experiments, or precipitate's presence during transportation process which caused a change of materials' concentration etc. In addition, we also made blank liposomes, which have relatively small diameters than drug-loaded liposomes. We later used LA-Dox made on 13th and 16th; LA blank liposomes made on 16th, which have relative small diameters and Pdi.
We also got some graphs using specific software to show the distribution of particle size.
Encapsulation rate testing of Dox-Liposome
To measure encapsulation rate of Dox-Liposome, we need to know the amount or concentration of initial doxorubicin and free doxorubicin after purifying. Therefore, we made a doxorubicin gradient which showed the relation between doxorubicin concentration and its absorbance under 485nm waves. All the experiments were repeated at least three times, and error bars represent SEM. a.u. arbitrary units to guarantee the accuracy of the gradient and Figure 2.2 shows one of the gradient (the orange line) with the R2 value (0.9983)>0.99, symbolizing its desirable imitative effect.
After that, we took 200 μL of initial solution and supernates from centrifugation of the original solution each to test their absorbance using microplate reader under 485 nm waves, and used the equation we got to calculate their concentrations thus their amounts. By utilizing the formula:
$$\text{Encapsulation Rate} = \frac{(\text{Amount of initial Dox} - \text{Free Dox})}{\text{Amount of initial Dox} \times \text{100%}}$$
we obtained the encapsulation results, presented in Table 2.4.
The results showed us that we had successfully wrapped the drugs inside with different degrees (from 27% to 67%). The rates aren't high enough compared to results we found in thesis or other researches, but considering that dox is a highly toxic drug and our aim is to make more numbers of nanoparticles with less drugs each to prevent side effects, the results are acceptable.
Modification of Doxorubicin Liposome with Aptamer
To connect aptamers onto liposomes, we utilized EDC/HNS method for coupling the carboxylic group on PEG and amine group on aptamers. Specifically, this included activation of carboxylic group on PEGylated liposomes first under EDC/NHS environment and then incubation in certain temperature with NH2-modified aptamers. We conjugated HR2 Aptamers onto LA-Dox 13, 16 and LA-16.
The first time we used Dox-liposomes for aptamer modification and got our first result shown in Figure 2.3A. From the figure, we can see a free aptamer running to about 100bp place. We expected that, for aptamer-dox liposome, there were fluorescences at the original place as the conjugated aptamer could no longer run to 100bp place like free aptamer. There were also light bands in aptamer-dox liposomes' lanes, which indicated that we hadn't removed all the free aptamer the first time. Nevertheless, the biggest problem we found was that doxorubicin itself has strong fluorescences that can cover the fluorescences of the aptamer.
To solve these issues, we decided to use blank liposomes to conjugate aptamer first, and then diffuse Dox into the liposome later.
Figure 2.3B showed the results of electrophoresis of aptamer-blank liposomes. Without the disruption of dox fluorescences, we found there are pale fluorescences bands at the original places, showing our success in conjugation.
We also use some blank liposomes as control groups. From Figure 2.3C, there were no fluorescences in lane 7 but fluorescences in lanes 4 and 5, showing blank liposomes hardly affect the fluorescences. However, there were fluorescences in lane 6, which is also blank liposomes. This could be caused by contamination of nearby samples, or because we used liposome's precipitate for electrophoresis that time to increase the concentration, as the precipitate was macroscopic.
Ammonium sulphate diffusion
After verifying that blank liposomes had been successfully modified by aptamer, we used ammonium sulphate gradient to help diffuse doxorubicin into liposomes. The nature of this method was let inside ammonium sulphate "drags" doxorubicin outside into liposomes by forming Doxorubicin-sulphate precipitates. Therefore, it was very important to wash away all ammonium sulphate outside the liposomes. The method succeeded when we found red precipitate after the diffusion process, showing that red doxorubicin went into liposomes.
The Dox-Liposomes made in this method were not used in the cell culturing experiment, however, it provides evidence of possible methods to produce liposomes as well as proof of successful aptamer conjugation.
PLGA nanoparticle
We hope to synthesis PLGA nanoparticle entrapping doxorubicin. To prepare the nanoparticle, we used the single emulsion-solvent evaporation method, which synthesizes particles entrapping hydrophobic or amphiphilic contents. Briefly, the polymer and the drug were dissolved in an organic solvent, which was then mixed and sonicated with an aqueous phase containing surfactants, forming an oil-in-water emulsion. The organic solvent was allowed to evaporate, which hardens particles and formed a nanoparticle suspension. Please go to our Protocol Summary for detailed procedures.
Initially, we attempted to produce nanoparticles with an output power of 500W. The diameter of the particle produced is shown in Figure 3.1.
Our result indicates that the average diameter is 2.5um, which is too large for a delivery platform for anticancer drugs, whose diameter is usually between 70-200nm[7]. Therefore, after consulting Dr. Wei, we realized that the output power was inadequate for the production of smaller particles, and a new batch of particles was produced with a sonication output power of 800W.
With enhanced output power, nanoparticles of diameter of 251nm were obtained. The morphology of the particle was characterised with transmission electron microscope Figure 3.3.
In VitroI Verification
Cell Culturing
Cell lines of SK-BR-3 (human breast, HER2 positive), MDA-MB-231 (human breast, HER2 negative), obtained form National Collection of Authenticated Cell Cultures (Shanghai,China), was cultivated using DMEM medium supplemented with 10% fetal bovine serum in 5% CO2 at 37°C. The morphology of the cell was shown in Figure 4.1. For details of cell thawing and subsulturing, please visit our Protocol Summary.
Evaluation of Cytotoxicity of Dox
To evaluate the cell cytotoxicity of Doxorubicin, both cell lines were cultivated in 96 well plate for 24 hour, with approximately then the DMEM growth medium was removed and the cells were incubated with Dox containing DMEM at various concentration. For previous study has shown that doxorubicin caused a decrease of more than 80% of cell viability in B16F10 murine melanoma cell lines at 24 hours, 1 μg/ml[6], the experiment was designed to tested the cytotoxicity on both cell lines imposed by Dox at a similar time interval and concentration. After co-incubation with doxorubicin, the cell viability was tested with CCK-8 kits. The result of our experiment was shown in Figure 4.2.
The data suggests that similar to that of the previous literature, no significant cytotoxic effect was exhibited by doxorubicin after 3 hours of co-incubation, possibly because the time interval was inadequate Dox to exert its cytotoxic effects. To our relief, at 24 hours a general trend was shown that the cell viability decreases as the concentration of Dox in the growth medium increases, though the exhibited cytotoxicity on both SK-BR-3 and MDA- MB-231 cell lines was smaller than that on B16F10. We could use this result to decide on the Dox concentration that should be encapsulated into the nanoparticles to produce enough effects to kill the cancer cell.
Evaluation of Cytotoxicity of Apt-Dox-Liposome
To prove that our system could work as a whole, we tested the cytotoxic efficacies of Apt-Dox-Liposome, on HER2-positive and HER2 negative cell lines using the same method as above. The Liposome drugs we used are LA-Dox-13 and LA-16, which can be found in the previous part above.
From Figure 4.3, the data showed that while sole Dox entrapping liposome exhibits similar cytotoxicity against both HER2-positive and HER2-negative cells, the aptamer conjugated liposome shows an increased cytotoxic effect against the HER2 positive cell, and a reduced cytotoxic effect on the HER2 negative cell, which indicates that, presumably due to the successful binding to the HER2 extracellular domain by the aptamer, a greater amount of Dox is delivered to the targeted cancer cell.
However, the cell viability of Dox-Liposome is even lower than that of the 20 μg/ml Dox group even though it contains the same concentration of Dox. Presumably, this is due to the cytotoxicity of liposomes, during liposome production, the chemical remains unremoved, thus damaging the cell. This is a deficiency of the system we may consider in the future.
The data suggests, preliminarily, that our HER2 aptamer-liposome delivery system could selectively deliver Doxorubicin in vitro, and could possibly exhibit decreased cytotoxic effects on normal cells. However, the experimental data now is not sufficient enough to prove the effectiveness as repeating data is missing.
Summary
Our experimental results have provided preliminary evidence for the possibility of such a targeted drug. We have successfully tested HR2 Aptamer's binding affinity against HER2 through ELONA and utilized it on synthesized liposome nanoparticles. Finally, we were able to perform in vitro cytotoxicity tests to show the overall effectiveness of the drugs.
However, due to lack of time, there are still things we have not yet finished, which we present below.
Outlook
If OncoKiller can be refined and optimized it could become a universal model for many cancer drugs. Due to the accessibility of aptamers and their versatility, drugs for diverse cancers can be produced using our system, but with different aptamers. For example, targeted drugs for liver cancer can apply aptamers specifically binding to liver cancer cells instead of HER2 aptamers; Triple Negative breast cancer can be targeted with aptamer even though there are no receptors for antibodies to target. We believe that using aptamers in cancer-curing drugs is very prosperous, as it not only explores more opportunities but also allowing more families to be able to afford them.
In the past few months, we've read through literature performed experiments; we overcame many difficulties, tried out different solutions, and eventually led to our preliminary design for our project. Fighting cancer is hard. We know our targeting drug has many issues yet to be solved, but we wish to do our bit in this long-stretched fight.
Reference
- Niazi, J. H., Verma, S. K., Niazi, S., & Qureshi, A. (2015). In vitro HER2 protein-induced affinity dissociation of carbon nanotube-wrapped anti-HER2 aptamers for HER2 protein detection. The Analyst, 140(1), 243–249. https://doi.org/10.1039/c4an01665c
- Liu, Z., Duan, J. H., Song, Y. M., Ma, J., Wang, F. D., Lu, X., & Yang, X. D. (2012). Novel HER2 aptamer selectively delivers cytotoxic drug to HER2-positive breast cancer cells in vitro. Journal of translational medicine, 10, 148. https://doi.org/10.1186/1479-5876-10-148
- Marimuthu C, Thean-Hock Tang, Soo-Choon Tan, Chee-Hock Hoe, Rajan Saini, Junji Tominaga and Subash C.B. Gopinath songklanakarin J. Sci. Technol. 34 (2), 125-131, Mar. - Apr. 2012
- Tannock, I. F., & Rotin, D. (1989). Acid pH in tumors and its potential for therapeutic exploitation. Cancer research, 49(16), 4373–4384.
- Thompson, I., Zheng, L., Eisenstein, M., & Soh, H. T. (2020). Rational design of aptamer switches with programmable pH response. Nature communications, 11(1), 2946. https://doi.org/10.1038/s41467-020-16808-2
- Gaumet, M., Vargas, A., Gurny, R., & Delie, F. (2008). Nanoparticles for drug delivery: the need for precision in reporting particle size parameters. European journal of pharmaceutics and biopharmaceutics : official journal of Arbeitsgemeinschaft fur Pharmazeutische Verfahrenstechnik e.V, 69(1), 1–9. https://doi.org/10.1016/j.ejpb.2007.08.001
- Eliaz, R. E., Nir, S., Marty, C., & Szoka, F. C., Jr (2004). Determination and modeling of kinetics of cancer cell killing by doxorubicin and doxorubicin encapsulated in targeted liposomes. Cancer research, 64(2), 711–718. https://doi.org/10.1158/0008-5472.can-03-0654