Team:ZJU-China/Results
Result
The results of all our design will be shown in this page. So far we had finished all our scheduled experiments and the results had proved the reliability and feasibility of our design to some extent. However, some picture may be not that beautiful because of the lack of time, and we are still conducting experiments for a better results. Besides, the results of how our designs work in the packaged oncolytic virus will soon be added.
1. Immunocamouflage
Part 1.1 Plasmid construction
From the InvivoGen[1], we got the sequences of ODN-2216、ODN-2243(Ctrl) and TLR9i(ODN-TTAGGG).
ODN 2216 is an A-class CpG ODN with a preference for human TLR9, which are characterized by a phosphodiester central CpG-containing palindromic motif and a phosphorothioate 3' poly-G string. They induce high IFN-α production from peripheral blood mononuclear cells (PBMC). ODN 2243 (also known as ODN 2216 Control) is designed as a negative control for the TLR9 agonist ODN 2216.
ODN TTAGGG contains 4 repeats of the immunosuppressive TTAGGG motif which could inhibit immune activation by CpG-containing ODNs.
In order to verify the effect of TLR9i, we directly linked ODN2216 sequence with TLR9i sequence, inserted it into pcDNA3.1(+)-C-eGFP plasmid through traditional restriction digestion and ligation method and named it ODN2216+TLR9i. For making the inhibit effect of TLR9i more obvious, we inserted four copies of TLR9i (ODN-TTAGGG) separated by short AAAAA linkers. In the same way, we constructed a control plasmid named ODN2216+Ctrl.
| Name | Sequence |
|---|---|
| ODN-2216 | 5'-ggGGGACGATCGTCgggggg-3' |
| ODN-2243 | 5'-ggGGGAGCATGCTGgggggg-3' |
| ODN-TTAGGG | 5'- ttagggttagggttagggttaggg-3' |
| ODN2216+TLR9i | 5'-ggGGGACGATCGTCggggggTTAGGGTTAGGGTTAGGGTTAGGGaaaaaTTAGGGTTAGGGTTAGGGTTAGGGaaaaaTTAGGGTTAGGGTTAGGGTTAGGGaaaaaTTAGGGTTAGGGTTAGGGTTAGGG-3' |
| ODN2216+Ctrl | 5'-ggGGGACGATCGTCggggggGGGGGAGCATGCTGGGGAGCATGCTGGGGAGCATGCTGGGGAGCATGCTGGGGGGGG-3' |
(a) Agarose electrophoresis of ODN2216+TLR9i before and after digestion. Lane 1 is ODN2216+TLR9i plasmid in three conformations. Lane 2 is ODN2216+TLR9i plasmid digested by EcoRI and MluI. Lane M is 1 KB ladder. (b) Agarose electrophoresis of ODN2216+Ctrl before and after digestion. Lane 1 is ODN2216+Ctrl plasmid in three conformations. Lane 2 is ODN2216+Ctrl plasmid digested by EcoRI and MluI. Lane M is 1 KB ladder. (c) 1 KB ladder. Each band are marked with corresponding length.
Part 1.2 IFN-α concentration following transfection
We transfected ODN2216+TLR9i, ODN2216+TLR9i and empty plasmid into PBMC respectively. The supernatants were collected 48h after transfection and the levels of IFN-α production were measured in supernatants using a sandwich-type enzyme-linked immunosorbent assay (ELISA) kit (Dakewe Biotech Co., Ltd.), according to the manufacturer's instructions.
Due to the low transfection efficiency of traditional liposome transfection and electroporation transfection methods on immune/hematology related cells such as PBMC, ODN2216+TLR9i group, and the blank group did not reach the detection limit, but we can see the difference in absorbance. The absorbance value of ODN2216+Ctrl group was significantly higher than that of ODN2216+TLR9i group. Therefore, to an extent, it might suggest that TLR9i can compete to bind TLR9, triggering less downstream signal transduction, thus reducing the production of IFN-α and decreasing the immune response. As the virus transfection efficiency is higher, we will further explore in the follow-up virus experiment.
2. Targeted-infection part
Part 2.1 Our fusion strategy
(1) Design of fusion protein
Our aim is to fuse the single-chain variable antibody(scFv) of GPC3 to the C-terminal of virus coat protein, fiber. In order to achieve this, we used (G)4S flexible joint to connect the heavy chain variable region and light chain variable region of anti-GPC3 antibody, resulting in scFv of anti-GPC3. Then scFv is fused to the C-terminal of fiber protein through (G)4S flexible joint so that scFv will be expressed together with the fiber protein of the virus and present on the surface of the virus (as is shown in Figure 2-1).
(2) Protein and DNA sequence of scFv
The following figure shows the amino acid sequence of the fusion protein of fiber knob region (C-terminal) and scFv. The blue part shows the fiber protein knob region, and the red part shows VH and VL regions of anti-GPC3 antibody.
The following figure shows the DNA sequence of scFv. The red part is the VH and VL regions of anti-GPC3 antibody.
(3) 3D structural prediction of fusion protein
We know that the strategy of modifying the virus fiber protein may greatly affect the assembly of fiber trimer, further affect the efficiency of virus intracellular assembly and amplification, and affect the virus titer[2]. Therefore, we made a de novo prediction on the structure of the fusion protein by an online website[3]. Fig. 2-4 shows a three-dimensional structure of the knob region trimer of adenovirus type 5 fiber protein downloaded from the PDB structure database[4]. The results (Fig. 2-5) show that the fusion protein did not affect the structure of the fiber protein knob region.
Part 2.2 Prokaryotic expression and purification of anti-GPC3 scFv protein
(1) Construction of prokaryotic expression plasmid of anti-GPC3 scFv protein
Since the virus packaging takes a long time and the virus experiment has higher requirements for the laboratory, we decided to express scFv protein in prokaryotic first, and then verify its activity. The prokaryotic expression vector we selected is pET28a (+), which has a T7 promoter (controlled by lac operon) and kanamycin resistance. Then we constructed scFv into the target vector by enzyme digestion (EcoR I and Hind III restriction endonuclease) and T4 ligation. As is shown in Fig. 2-6, we successfully inserted the DNA sequence (801bp) of scFv into the target vector.
(2) Solution to rare codon problem
After the construction of scFv expression plasmid, we transformed it into shuffle T7 competent cells for protein expression, but it was found that scFv protein was not successfully expressed by SDS-PAGE. After checking our sequence, we found what the problem was. It turned out that although we optimized the codons of VH and VL regions of scFv, we ignored whether the flexible joints connecting them had rare codons. Unfortunately, it did. Therefore, we know that Rosetta competent cell contains a plasmid that can express rare codons, pRARE [5](as shown in Fig. 2-7). So this may help us express scFv successfully.
(3) Dual plasmid co-transformation strategy
Since shuffle T7 strain constitutively expresses disulfide isomerase DsbC compared with Rosetta strain, this may help more soluble expression of foreign proteins. Therefore, we co-transformed scFv expression plasmid and pRARE helper plasmid into shuffle T7 strain. After dual antibiotics screening(Kan and Cm), we successfully obtained the strain carrying double plasmid (as shown in Fig. 2-8).
(4) Detection of Protein expression——selection of expression strain
We compared the expression of scFv protein in several different hosts, and the results are shown in Fig. 2-9. Before IPTG induction, scFv protein was almost not expressed, indicating that our expression plasmid has strong robustness. After induction, scFv protein was successfully expressed. Compared with shuffle T7 strain carrying only expression plasmid, Rosetta strain carrying both pRARE plasmid and expression plasmid and shuffle T7 strain carrying both expression plasmid and pRARE plasmid had significantly enhanced protein expression. In shuffle T7 strain carrying only expression plasmid, the protein mainly existed in soluble form, but the amount was a little small. When two plasmids exist in the same host, the expression of total protein and soluble protein increased significantly, but many proteins also appeared in the inclusion body. However, only in Rosetta strain, the expression of soluble protein was very small. Our results also confirmed the rationality of the dual plasmid transformation strategy [6].
(5) Exploration of optimal expression conditions
Although we successfully expressed scFv protein, most of the protein still existed in the form of an inclusion body. We extracted and purified the inclusion body protein and verified that it had no activity. In addition, the refolding steps of inclusion body protein are very complex and can not guarantee 100% recovery of activity, so we chose soluble protein. Therefore, we explored the best conditions, including temperature, inducer concentration, and induction time, in order to obtain the most soluble expression.
Firstly, the protein can have time enough to be folded by reducing the speed of protein synthesis. Therefore, it can be achieved by reducing the temperature and the induced IPTG concentration. We selected four temperature gradients of 10 ℃, 20 ℃, 30 ℃ and 37 ℃. The results showed that with the decrease of temperature, the expression of total scFv protein decreased, but the expression of soluble protein first increased and then decreased (as shown in Fig10 a). We obtained that the optimum expression temperature for soluble protein was 20 ℃. That may be because there is higher dissolved oxygen at low temperature to prevent the anaerobic growth of bacteria from producing a large amount of acetic acid; Secondly, the half-life of antibiotics was longer and the plasmid stability was higher when cultured at low temperature. Moreover, protein has a lower degradation rate and soluble protein has higher stability at low temperatures. Finally, some researchers also believe that low temperature can change the dynamics of peptide folding and increase the amount of correctly folded proteins.
Then, we investigated the effects of different IPTG concentrations on soluble protein expression at 20 ℃. Results, as shown in Fig10 b, the expression of total protein, increased with the increase of IPTG concentration within the given four gradient ranges. However, the detection of soluble protein showed that there was no significant relationship between soluble protein expression and IPTG concentration. This shows that even at low IPTG concentration, the expression of total protein is still excessive, so there are still enough proteins to enter the correct folding process.
Finally, we explored whether the induction time would significantly affect the expression of soluble protein. Results, as shown in Fig10 c, the expression of total protein and soluble protein, increased with the increase of induction time, but the increase of protein expression was not obvious after 18h.
In addition, more strategies to improve the soluble expression of foreign proteins are mentioned in the literature [7]. Including adding special factors to the culture medium to help protein folding; Select appropriate vectors, such as vector pet32b (+) with soluble fusion label or vector with a secretory label; Some metal ions can also improve the soluble expression of protein; Change the composition of the medium or add protease inhibitors. However, due to lack of time, we did not make further exploration.
(6) Purification of soluble scFv protein from Escherichia coli
After optimizing the expression conditions of soluble protein, we need to purify the protein. pET28a (+) vector has double His-tags, which means that we can purify it by Ni column affinity chromatography. The purification effect is shown in Fig. 2-11. Most of the miscellaneous proteins are washed off by washing a solution of low imidazole concentration, and then the adsorbed scFv protein is eluted off by eluent of high imidazole concentration. By collecting the eluent tube by tube, we get a relatively pure scFv protein. In the future, we can explore more suitable purification conditions, such as increasing the amount of washing solution or using gradient elution. The purified protein sample was added with equal volume glycerol and stored at - 20 ℃.
(7) Determination of concentration of scFv protein after purification
Because the purified scFv protein is not very pure, the actual scFv protein concentration obtained by BCA protein concentration quantitative method will be very inaccurate. Therefore, we used Coomassie Blue Staining to determine the protein concentration. Use a series of standard protein samples with known concentrations and purified protein samples to run SDS-PAGE gel and stain with Coomassie brilliant blue (as shown in Fig 2-12 (a)), use Image J for gray analysis, make a standard curve (as shown in Fig. 2-12 (b)), and calculate the protein concentration represented by the target band in the sample through the standard curve. Finally, the concentration of scFv in the purified sample was 26.74ug/ml(as shown in Fig. 2-12 (c)).
Part 2.3 Identification of scFv activity
（1）The activity of scFv protein was detected by Western blot
After obtaining the purified soluble scFv protein, we need to verify its activity to ensure that it can recognize GPC3 antigen. Firstly, after running SDS-PAGE gel with the recombinant human GPC3 sample, we detected the recombinant GPC3 antigen with the commercially available polyclonal antibody against GPC3 and anti-GPC3 scFv respectively (as shown in Fig. 2-13 (a)). Next, we prepared HepG2 cell lysate and detected its GPC3 antigen by Western blot. The commercial polyclonal antibody against GPC3 successfully detected GPC3 core protein(full length, 66kD) and the C-terminal of the cleaved GPC3 protein(30kd) (as shown in Fig. 2-13 (b)), and scFv detected GPC3 core protein(full length, 66kD), the N-terminal of the cleaved GPC3 protein(40KD), and some glycated GPC3 proteins (as shown in Fig13 (c)). These results are consistent with those in the literature[8-10]. The full-length GPC3 can be cut into small subunits of 40KD and 30kd and can be glycated. Meanwhile, It shows that anti-GPC3 scFv has high affinity and specificity.
(a)The detection of the recombinant GPC3 antigen with the commercially available polyclonal antibody against GPC3 and anti-GPC3 scFv respectively. (b)The detection of the endogenous GPC3 antigen of hepG2 cell with the commercially available polyclonal antibody against GPC3. (c)The detection of the endogenous GPC3 antigen of hepG2 cell with the anti-GPC3 scFv.
（2）The detection of Kd value by ELISA
Next, we want to make some quantitative characterization of scFv to prove that scFv has high affinity. One of the most powerful representatives is determine the Kd (ligand concentration that binds to half the receptor sites at equilibrium) and Bmax (maximum number of binding sites). Therefore, we can use hill model (Y= Bmax*X^h / (Kd^h+X^h)) to equate the kinetics of specific binding[11].
We selected the polyclonal antibody of GPC3 and the nucleic acid aptamer specific for liver cancer cells to compare with scFv. The concentration dependence of their specific binding was characterized by ELISA. The determination results of polyclonal antibody, scFv and aptamer are shown in Fig. 2-14, Fig. 2-15 and Fig. 2-16, respectively. The Kd value of the polyclonal antibody of GPC3 is several hundreds ng/ml (as shown in Fig. 2-14), while the Kd value of scFv reaches several tens ng/ml (as shown in Fig. 2-15), which shows that the affinity of scFv for GPC3 is dozens of times that of the polyclonal antibody. Although the reported Kd values of TLS11a aptamer for hepatoma cells reached 4.51nm/ml and 7.16nm/ml for the mouse hepatoma cell line (MEAR cell line) and human hepatoma cell line LH86 [12], our results showed that TLS11a did not specifically bind to HepG hepatoma cell line (as shown in Fig. 2-16). In conclusion, the results show the high affinity of scFv.
（3）Cellular immunofluorescence
In order to prove that anti-GPC3 scFv can bind to the membrane of HepG2 cells, we did immunofluorescence experiment. The results show that scFv has good membrane binding characteristics, which can help our recombinant adenovirus bind to the cell surface by the interaction between scFv and GPC3. In addition to the fluorescence on the membrane, the group of polyclonal antibodies also has strong fluorescence in the cytoplasm, especially in Golgi, which may be related to the nonspecific binding of polyclonal antibodies and the cleavage of GPC3 by Furin protease in Golgi [13]. Although TLS11a is considered to bind to the membrane protein of hepatoma cells, the results of cellular immunofluorescence do not show good membrane binding characteristics, which is consistent with the reported literature [14].
（4） Flow cytometry
In addition to the above experiments, we also analyzed the binding of scFv to HepG2 cells by flow cytometry. As shown in Fig. 2-18, compared with the control group, the probability of FITC positive cells in His-scFv group increased significantly and increased in a concentration dependent manner.
3. Specific replication
PART 3.1 SEQUENCE PART
3'UTR Sequence 226bp
< GCAGATCTAGATCTTAAAGCTTGCCACTGAAGAACTTTAGGGTTAGGGTTAGGGTTAGGGGAACAGGTAGTCTGAACACTGGGTTAGGGTTAGGGTTAGGGTTAGGGGCCAATATTTCTGTGCTGCTATTAGGGTTAGGGTTAGGGTTAGGGGAACAGGTAGTCTGAACACTGGGTTAGGGTTAGGGTTAGGGTTAGGGGAACAGGTAGTCTGAACACTGGGCTGCAGTGCA
Sponge Sequence 284bp
< TAAACTTGCCACTGAAGAACTCGATGCCAATTATCTGTGCTGCTATCACGAACGGTATCTGAACACTGGGAAAGTAAAGCTGCCTCTGAAGAACTGGAATGGCCAATATGCTGTGCTGCTAGTCTACGAACAGTGGCCTGAACACTGGGCTAGTGAATGGTAGTGTGAACACTGGGCACGGTAGACCTTGACTGAAGAACTAATACGCTAATATTTGTGCTGCTACTTATTAAATCTTGCCGCTGAAGAACTCGATGAAGGGTCTGAACACTGGGGCCACCATG
PART 3.2 Construction of 3'UTR, sponge, and null plasmid
p3UTR and pSp were generated by Genescript.
The successful construction of empty plasmid was confirmed by colonial PCR with primers 3UTR-EMPTY-F and 3UTR-EMPTY-R in Figure. 3-1 and agarose electrophoresis. The result shows in Figure. 3-2.
Primers Null_1R and Null_F are used to construct p3'Unull. Primers 3UTR-EMPTY-F and 3UTR-EMPTY-R are used to verify the successful construction of p3'Unull. Using p3UTR as an example here, the construction of pSp and pSp null are same with it.
PART 3.3 miRNAs content measurement
We used Bulge-Loop primer set from Ribobio to detect miRNA expression and differential analysis based on qPCR detection technology, and we chose U6-1 as our internal reference which was a component of splicing complex. We then performed a statistical analysis of all valid experimental results. The results for ANOVA are as follows in Table. 3-1. And to further understand the miRNA content difference in different cell types, LNK test under the context of ANOVA were performed, the result of which were shown in Table. 3-2.
| Analysis of Variance Table | ||||||
|---|---|---|---|---|---|---|
| Df | Sum Sq | Mean Sq | F value | Pr(>F) | Explained% | |
| Cell_Line | 1 | 6.131 | 6.131 | 57.158 | 5.021e-08*** | 21.3628 |
| miRNA | 2 | 19.7794 | 9.8897 | 92.201 | 1.567e-12 *** | 68.91973 |
| Residuals | 26 | 2.7888 | 0.1073 | 9.717479 |
| LNK test | ||||
|---|---|---|---|---|
| Difference | pvalue | signif. | LCL | UCL |
| hek 293:195/U6 - hep G2:195/U6 | 0.917866 | 0.0002*** | 0.4833124 | 1.35241972 |
| hek 293:199/U6 - hep G2:199/U6 | 0.7182263 | 0.0046** | 0.2421966 | 1.19425602 |
| hek 293:22/U6 - hep G2:22/U6 | 0.6522051 | 0.0019** | 0.2635285 | 1.04088176 |
The statistical mapping is shown as following in Figure. 3-3.
This diagram shows the relative content of miRNA hsa-miR-199a, hsa-miR-195, hsa-miR-22 from HEK293T cell line and HepG2 cell line. We used reverse transcription and quantitative real-time PCR, and we choose U6-1 as our internal reference. The result shows that hsa-miR-199a, hsa-miR-195 and hsa-miR-22 express lower in HepG2 cell line than those in HEK293T cell line.
PART 3.4 Test of the function of the p3UTR and pSp
The data we obtained were processed the results of which are shown in Figure. 3-4.
The results showed that in Hek293T transfected with p3u, the expression of eGFP was inhibited, which was not significant enough in HepG2. (p<0.1) It demonstrated that the miRNA concentration in normal cells were likely to be sufficient to inhibit the E1A.
We also designed plasmids called pRNAiU6.2-22, pRNAiU6.2-195, pRNAiU6.2-199a to increase the quantity of these miRNA in HepG2 as described previously. That was how we could know if the effect of 3UTR was actually caused by miRNA or other variables. Thus, we transfected 3u and one of these plasmids above into HepG2. The group called 3u+u6 was the controlled group, and u6 referred to pRNAiU6 without extra part. The results are shown in Figure. 3-5. Comparatively, the expressions of eGFP were all significantly decreased in HepG2 when these miRNA were replenished in cells, mir195 was the most effective one of these three. It showed that the function of 3u was related to the quantity of these miRNA, and it was reasonable to control the expression of E1A though the controlling of miRNA content.
To further verify the specificity of the virus, we also tested the function of the designed miRNA sponges. HepG2 were transfected with 3u and sponges (sponge-pcDNA3.1-P2A-C,or sp), and the controlled group were transfected with null sponge plasmid (sponge-empty-pcDNA3.1-P2A-C, or spe), the ratio of these two plasmids was from 1:1 to 1:4. The statistical analysis results were listed below in Table. 3-3 and Table. 3-4.
| Df | Sum Sq | Mean Sq | F value | Pr(>F) | |
|---|---|---|---|---|---|
| sp and spe | 1 | 1187040 | 1187040 | 20.9136 | 0.0005226*** |
| concentration gradient | 1 | 93174 | 93174 | 1.6416 | 0.2224950 |
| Residuals | 13 | 737869 | 56759 |
| Difference | pvalue | signif. | LCL | UCL | |
|---|---|---|---|---|---|
| 3U+sp:1:1 - 3U+spe:1:1 | 384.491282 | 0.0399 | * | 20.55030 | 748.4323 |
| 3U+sp:1:3 - 3U+spe:1:3 | 705.022404 | 0.0011 | ** | 341.08142 | 1068.9634 |
According to Fig. 3-6 (a), in Hek293T, when the ratio of the 3u and the pSp or pSp null was 1:3, the expression of the eGFP was significantly lowered. Fig. 3-6 (b) shows that in HepG2, the significance was shown also when the ratio was 1:3. LSD test also showed the same results. Fig.3-7 shows the results under the microscope. Meanwhile, as shown in Table. 3-3, when the ratios of the two plasmids (sponge or sponge empty and 3u) are regarded as a covariate, the difference between the experimental group and the control group is significant, which indicates that sponges are able to increase the expressions of the eGFP. The data used in the statistical analysis is listed in the following supplementary materials. However, as the sponges also increased the expression of that genes in Hek293T, which represent normal cells, we should advocate some further improvements in the specificity of the sponge parts .
The expression of the eGFP in HepG2 was higher than that in Hek293T. Meanwhile, when the condition was controlled, the expression of 3U increased when the quantity of pSp was three times of p3U.
We provide some supplementary materials.
4. Oncolytic Virulence
Part 4.1 Sequence Part
With the help of thermofisher online shRNA design tools, BLOCK-iT? RNAi Designer[15] we had designed three types of shRNA for each gene based on the information from the NCBI database. Their sequence are as following (Table .4-1) .
| Name | Sequence |
|---|---|
| hTERT-1-F | AATTCGCTCGTGGAGACCATCTTTCTTTCAAGAGAAGAAAGATGGTCTCCACGAGCTTTTTTG |
| hTERT-1-R | GATCCAAAAAAGCTCGTGGAGACCATCTTTCTTCTCTTGAAAGAAAGATGGTCTCCACGAGCG |
| hTERT-2-F | AATTCGGAAGAGTGTCTGGAGCAAGTTTCAAGAGAACTTGCTCCAGACACTCTTCCTTTTTTG |
| hTERT-2-R | GATCCAAAAAAGGAAGAGTGTCTGGAGCAAGTTCTCTTGAAACTTGCTCCAGACACTCTTCCG |
| hTERT-3-F | AATTCGGAAGACAGTGGTGAACTTCCTTCAAGAGAGGAAGTTCACCACTGTCTTCCTTTTTTG |
| hTERT-3-R | GATCCAAAAAAGGAAGACAGTGGTGAACTTCCTCTCTTGAAGGAAGTTCACCACTGTCTTCCG |
| VEGFA-1-F | AATTCGCAGATTATGCGGATCAAACCTTCAAGAGAGGTTTGATCCGCATAATCTGCTTTTTTG |
| VEGFA-1-R | GATCCAAAAAAGCAGATTATGCGGATCAAACCTCTCTTGAAGGTTTGATCCGCATAATCTGCG |
| VEGFA-2-F | AATTCGCGCAAGAAATCCCGGTATAATTCAAGAGATTATACCGGGATTTCTTGCGCTTTTTTG |
| VEGFA-2-R | GATCCAAAAAAGCGCAAGAAATCCCGGTATAATCTCTTGAATTATACCGGGATTTCTTGCGCG |
| VEGFA-3-F | AATTCGCGAGGCAGCTTGAGTTAAACTTCAAGAGAGTTTAACTCAAGCTGCCTCGCTTTTTTG |
| VEGFA-3-R | GATCCAAAAAAGCGAGGCAGCTTGAGTTAAACTCTCTTGAAGTTTAACTCAAGCTGCCTCGCG |
We found two functional *htert* and *survivin* promoter sequence in previous studies[16,17] and by searching for the *hTERT* and *SURVIVIN* genes in the NCBI database, we aligned the front part of the gene sequence to the promoter and designed corresponding primers (Table .4-2) . The primer sequences are as following.
| Name | Sequence |
|---|---|
| htert-F | ATTACCGCCATGCATGTTAACCAGCTGCGCTGTCGGGGCCAGG |
| htert-R | TAGCGCTAGCGGATCCATATGGCTGCCTGAAACTCGCGCCGCGA |
| survivin-F | ATTACCGCCATGCATGTTAACATTACAGGCATGCACCAC |
| survivin-R | TAGCGCTAGCGGATCCATATGAATCTGGCGGTTAATGGC |
After using the human genome as a template for PCR, we obtained the corresponding promoter sequence (Table .4-4) . The CMV promoter was removed from the pSB1C3 plasmid by using linearization primers (Table .4-3) to linearize the fragments other than the promoter sequence, and then the needed promoter was reloaded into the plasmid by homologous recombination, resulting in P*htert*-EGFP and P*survivin*-EGFP plasmids. After sequencing verification, it was found that the sequence of promoter met the expectation.
| Name | Sequence |
|---|---|
| CMV-linear-F | GATCCGCTAGCGCTACCG |
| CMV-linear-R | ATGCATGGCGGTAATACGGT |
| Name | Sequence |
|---|---|
| hTERT promoter Sequence 263bp | CAGCTGCGCTGTCGGGGCCAGGCCGGGCTCCCAGTGGATTCGCGGGCACAGACGCCCAGGACCGCGCTTCCCACGTGGCGGAGGGACTGGGGACCCGGGCACCCGTCCTGCCCCTTCACCTTCCAGCTCCGCCTCCTCCGCGCGGACCCCGCCCCGTCCCGACCCCTCCCGGGTCCCCGGCCCAGCCCCCTCCGGGCCCTCCCAGCCCCTCCCCTTCCTTTCCGCGGCCCCGCCCTCTCCTCGCGGCGCGAGTTTCAGGCAGC |
| survivin promoter Sequence 397bp | ATTACAGGCATGCACCACCACGCCCAGCTAATTTTTGTATTTTTAGTAGAGACAAGGTTTCACCGTGATGGCCAGGCTGGTCTTGAACTCCAGGACTCAAGTGATGCTCCTGCCTAGGCCTCTCAAAGTGTTGGGATTACAGGCGTGAGCCACTGCACCCGGCCTGCACGCGTTCTTTGAAAGCAGTCGAGGGGGCGCTAGGTGTGGGCAGGGACGAGCTGGCGCGGCGTCGCTGGGTGCACCGCGACCACGGGCAGAGCCACGCGGCGGGAGGACTACAACTCCCGGCACACCCCGCGCCGCCCCGCCTCTACTCCCAGAAGGCCGCGGGGGGTGGACCGCCTAAGAGGGCGTGCGCTCCCGACATGCCCCGCGGCGCGCCATTAACCGCCAGATT |
Part 4.2 shRNA part
To have an intuitive result, we used AnnexinV to analysis the apoptosis rate of the cells. We compared the apoptosis rate between shRNA transfected groups with the scramble group( shRNA without any targeting gene) and the GADPH group( shRNA targeting GADPH, used as positive control). The result had shown higher dead rate in the functional shRNA transfected groups than in the negative control group (scramble group) . Meanwhile, they had also shown an even or higher apoptosis rate than the positive control group (GADPH group), indicating the efficiency of the shRNA. These results showed that there is at least one type of efficient shRNA for each type of gene.
The qRT-PCR showed the same result from transcription level. The sramble groups showed higher mRNA expression level of *VEGFA* and *hTERT* than the processed groups, indicating the fact that our designed shRNA behaved well in the gene silence process. V1 and T1 shRNA surprisingly showed an increase of expression. This phenomenon may come from the inherent error of qRT-PCR. Actually, these two designed shRNA may had very little influence on the gene expression. The other four designed shRNA all had shown prominent reduction of gene expression, which had reached the efficient level of gene down-regulation.
As the qRT-PCR experiment has high uncertainty, we conducted Western Blotting to analyze the down-regulation from the translational level. We had chosen the shRNA which had shown the gene expression down-regulation effect in previous experiment. Though hTERT is a type of protein expressed in cancer cells, the expression level is quite low. Therefore, this low expression had led much trouble to the detection.
We used V2,V3,T2,T3 shRNA for the experiment. The expression level of VEGFA protein had been distinctly down-regulated by V2 (V2-2) while the result of V3 is not quite clear (Figure. 4-3) . The WB result of hTERT is not quite satisfying. As the expression level of hTERT is quite low, we had to adjust to an extent in which the background signal is also high. However, it still could be recognized that T2(T2-1) shRNA had shown distinct down-regulation effect (Figure .4-4) .
These results indicated that our designed shRNA are truly efficient. In the future we may choose other types of hepatic cancer cell lines or the primary hepatocarcinoma cells for further study, hoping that a better result can be obtained.
part 4.3 Promoter part
The promoter expression level was shown by the intensity of the green fluorescence. The higher the intensity, the more efficient the promoter is in the situation.
As the limitation of our condition, we only got HepG2 and HEK293T cells for recognizing the expression difference. We regarded HEK293T cells as the normal cell control group, though it is not a traditional somatic cell.
We analyzed two types of promoter: P*htert* and P*survivin*. The result showed a much higher intensity of P*survivin* induced green fluorescence expression in HepG2 cells than in Hek293T cells, while the intensity difference of P*htert* induced green fluorescence is not distinctly different between these two types of cell. We made the conclusion that P*survivin* is an ideal promoter to trigger tumor specific expression.
P*htert* may also be an ideal choice because it had shown a steadily higher expression in HepG2 cells, though the excess is not large. We suppose that this is because HEK293T cells is a type of human embryonic kidney cells. *hTERT* gene is also expressed in human embryonic[18], so the efficiency of the promoter is also high in HEK293T cells. However, we can also say that PhTERT owns a much higher expression ability in hepatic cancer cells than in normal cells. Because compared to cells in which P*hTERT* functioning the most efficiently among all other normal cells, P*hTERT* still had shown a higher efficiency in cancer cells. Therefore, we are able to prove the tumor specificity of the P*hTERT*. Later we decide to use normal hepatic cell lines, L-O2, for further study in order to get a more reliable result.
All in all, we had proved the tumor specific expression of P survivin and Phtert
5. Virus experiments part
Part 5.1 Recombined and packaged the virus
We inserted our circuit into the Ad5 virus missing E1 and E3. The titer of adenovirus was detected by TCID50 method. The virus stock solution was diluted gradient by limited dilution method, from 10-1 to 10-10. Starting from the highest dilution, 100ul for each dilution was added to holes 1 to 10 of 96 well plate inoculated with hek293a cells. After 10 days, CPE phenomenon of each hole was observed under inverted microscope. The results showed that the virus titer reached 3.49 × 10^10.
Part 5.2 Future experiments
Since virus packaging was difficult, it was not until recently that our virus packaging was completed. We have also planned virus experiments (see our experiment) and are working hard to carry out these experiments. If there are subsequent experimental results, we will update our wiki.
References
[1] https://www.invivogen.com/odn2216
[2] Hong, J. S., & Engler, J. A. (1996). Domains required for assembly of adenovirus type 2 fiber trimers. Journal of virology, 70(10), 7071–7078. https://doi.org/10.1128/JVI.70.10.7071-7078.1996
[3] https://zhanggroup.org/I-TASSER/
[4] https://www.rcsb.org
[5] Guo, Y., Wallace, S. S., & Bandaru, V. (2009). A novel bicistronic vector for overexpressing Mycobacterium tuberculosis proteins in Escherichia coli. Protein expression and purification, 65(2), 230–237. https://doi.org/10.1016/j.pep.2008.12.013
[6] Kong, B., & Guo, G. L. (2014). Soluble expression of disulfide bond containing proteins FGF15 and FGF19 in the cytoplasm of Escherichia coli. PloS one, 9(1), e85890. https://doi.org/10.1371/journal.pone.0085890
[7] Ma, Y., He, J., &Kang, Y.(2018). Reviews on Strategies of Enhance Heterologous Protein Soluble Expression in Escherichia Coli. WORLD-SCI-TECH R&D(05),627-630. doi:10.16507/j.issn.1006-6055.2015.05.033.
[8] Nakano, K., Orita, T., Nezu, J., Yoshino, T., Ohizumi, I., Sugimoto, M., Furugaki, K., Kinoshita, Y., Ishiguro, T., Hamakubo, T., Kodama, T., Aburatani, H., Yamada-Okabe, H., & Tsuchiya, M. (2009). Anti-glypican 3 antibodies cause ADCC against human hepatocellular carcinoma cells. Biochemical and biophysical research communications, 378(2), 279–284. https://doi.org/10.1016/j.bbrc.2008.11.033
[9] Hippo, Y., Watanabe, K., Watanabe, A., Midorikawa, Y., Yamamoto, S., Ihara, S., Tokita, S., Iwanari, H., Ito, Y., Nakano, K., Nezu, J., Tsunoda, H., Yoshino, T., Ohizumi, I., Tsuchiya, M., Ohnishi, S., Makuuchi, M., Hamakubo, T., Kodama, T., & Aburatani, H. (2004). Identification of soluble NH2-terminal fragment of glypican-3 as a serological marker for early-stage hepatocellular carcinoma. Cancer research, 64(7), 2418–2423. https://doi.org/10.1158/0008-5472.can-03-2191
[10] Traister, A., Shi, W., & Filmus, J. (2008). Mammalian Notum induces the release of glypicans and other GPI-anchored proteins from the cell surface. The Biochemical journal, 410(3), 503–511. https://doi.org/10.1042/BJ20070511
[11] https://www.graphpad.com/guides/prism/latest/curve-fitting/reg_specific_hill.htm
[12] Meng, L., Yang, L., Zhao, X., Zhang, L., Zhu, H., Liu, C., & Tan, W. (2012). Targeted delivery of chemotherapy agents using a liver cancer-specific aptamer. PloS one, 7(4), e33434. https://doi.org/10.1371/journal.pone.0033434
[13] Haruyama, Y., & Kataoka, H. (2016). Glypican-3 is a prognostic factor and an immunotherapeutic target in hepatocellular carcinoma. World journal of gastroenterology, 22(1), 275–283. https://doi.org/10.3748/wjg.v22.i1.275
[14]https://digital.library.txstate.edu/bitstream/handle/10877/6899/SUTTON-THESIS-2014.pdf?isAllowed=y&sequence=1
[15] http://rnaidesigner.thermofisher.com/rnaiexpress
[16]J. Yin, P. Fu, X. Wang, G. Jin, R. Xiu, Tumor-specific expression detected with the use of an expression vector driven by human telomerase reverse transcriptase gene promoter, J Lab Clin Med, 144(2004) 302-306.
[17]E. Sasso, G. Froechlich, G. Cotugno, A.M. D'Alise, C. Gentile, V. Bignone, M. De Lucia, B. Petrovic, G. Campadelli-Fiume, E. Scarselli, A. Nicosia, N. Zambrano, Replicative conditioning of Herpes simplex type 1 virus by Survivin promoter, combined to ERBB2 retargeting, improves tumour cell-restricted oncolysis, Sci Rep, 10(2020) 4307.
[18]S. Wang, C. Hu, J. Zhu, Transcriptional silencing of a novel hTERT reporter locus during in vitro differentiation of mouse embryonic stem cells, MOL. BIOL. CELL, 18(2007) 669-677.
FOLLOW US
