Team:ZJU-China/Experiments
Experiments
Our experiments are composed of four main parts: specifc recognition,miRNA controlled modulation, oncolytic virulence, and immunocamouflage. We tried to prove the feasibility of the whole design. Besides the final construction of the oncolytic virus, we still need to build multiple vectors for individual part and mechanism certification. All the proof methods are widely used and reliable experiments.
Immunocamouflage
Part 1 Construction of ODN 2216+Control, ODN 2216+TLR9i plasmid
From the InvivoGen, we got the sequences of ODN-2216、ODN-2243(Ctrl) and TLR9i(ODN-TTAGGG).
ODN 2216 is an A-class CpG ODN with a preference for human TLR9, which is characterized by a phosphodiester central CpG-containing palindromic motif and a phosphorothioate 3’ poly-G string. They induce high IFN-α production from peripheral blood mononuclear cells (PBMC). ODN 2243 (also known as ODN 2216 Control) is designed as a negative control for the TLR9 agonist ODN 2216.
ODN TTAGGG contains 4 repeats of the immunosuppressive TTAGGG motif which could inhibit immune activation by CpG-containing ODNs.
We entrusted the production of our plasmids, including plasmid ODN2216+Ctrl and plasmid ODN2216+TLR9i, to GenScript company, using the traditional restriction digestion and ligation method. For making inhibit the effect of TLR9i more obvious, we inserted four copies of TLR9i (ODN-TTAGGG) separated by short AAAAA linkers. We chose pcDNA3.1(+)-C-eGFP as our plasmid backbone, considering that this backbone has been used in our previously synthesized plasmids which could be conveniently taken as our control plasmid. Common restriction enzyme cutting sites EcoRI and BamHI were chosen in the meantime.
| Name | Sequence |
|---|---|
| ODN-2216 | 5'-ggGGGACGATCGTCgggggg-3' |
| ODN-2243 | 5'-ggGGGAGCATGCTGgggggg-3' |
| ODN-TTAGGG | 5'- ttagggttagggttagggttaggg-3' |
| ODN2216+TLR9i | 5'-ggGGGACGATCGTCggggggTTAGGGTTAGGGTTAGGGTTAGGGaaaaaTTAGGGTTAGGGTTAGGGTTAGGGaaaaaTTAGGGTTAGGGTTAGGGTTAGGGaaaaaTTAGGGTTAGGGTTAGGGTTAGGG-3' |
| ODN2216+Ctrl | 5'-ggGGGACGATCGTCggggggGGGGGAGCATGCTGGGGAGCATGCTGGGGAGCATGCTGGGGAGCATGCTGGGGGGGG-3' |
Part 2 Transfection of plasmids to PBMCs
PBMCs (Otwo Biotech Co., Ltd.) were plated in 24-well plates in RPMI-1640 medium supplemented with 10% fetal bovine serum and 1% Penestrep and maintained at 5% CO2 in air incubator at 37°C. PBMCs were transfected with the blank plasmid, ODN 2216+Ctrl, and ODN2216+TLR9i plasmids respectively. The cells were incubated for 48h. The collected supernatants were stored at 20°C until further use.
Part 3 Measurement of IFN-α
The supernatants were collected 48h after transfection and the levels of IFN-α production were measured in supernatants using a sandwich-type enzyme-linked immunosorbent assay (ELISA) kit (Dakewe Biotech Co., Ltd.), according to the manufacturer’s instructions.
Targeted infection
Part 1 Dual plasmid transformation
The obtained scfv-pet28a (+) plasmid and pRARE plasmid from Rosetta strain is added to shuffle T7 competent cells in the equimolecular amount; 30 min on ice; 42℃ 90 s; 2 min on ice; added non-resistant LB medium for resuscitation for 1 h, and then coated with Kan+Cm+ double-antibody LB plate. The single colony obtained is the transformed strain.
Part 2 Expression and Detection of scFv protein
1. Shuffle T7 strain containing scfv-pET28a (+) and pRARE plasmids (hereinafter referred to as RS strain) is selected and cultured in Kan+Cm+ LB liquid medium overnight. Shuffle T7 strain and Rosetta strain (hereinafter referred to as S strain and R strain respectively) transferred into scfv-pET28a (+) plasmid are selected and cultured in Kan+ LB liquid medium and Kan+Cm+ LB liquid medium overnight.
2. The next day, according to the transfer ratio of 1:100, transfer the overnight cultured RS, S and R bacteria into fresh LB liquid medium containing antibiotics, shake for about 3-4h to the absorbance of 0.4-0.6.
3. Inductor IPTG is added for induction. Pay attention to setting the control group without IPTG.
EXP A: Strains R, S and RS: Temperature-37 ℃; IPTG concentration-1 mm; induction time-12 h
EXP B: RS strain - Temperature gradient (IPTG: 1mm, induction time 12h): 10℃, 20℃, 30℃, 37℃.
IPTG concentration (temperature: 20℃, induction time: 12h): 0.1mm, 0.2mm, 0.5mm, 1mm. Induction time (temperature: 20 ℃, IPTG: 0.1mm): 6h, 12h, 18h, 24h.
4. The induced bacterial solution is centrifuged at 4000rpm at 4℃ for 3min; then resuspended the sediment using PBS, centrifuged and ished for 3 times.
5. Add an appropriate amount of (Xml+75ul) PBS for resuspension (at this time, protease inhibitor PMSF and lysozyme can be added), and absorb 75ul bacterial solution for retention.
6. Ultrasonic crushing until the bacterial solution is clear.
7. Centrifuge the crushed bacterial solution at 13000r at 4℃ for 10min, suck the supernatant (if you are doing a small amount of culture, only 75ul is needed, and the rest are discarded; if a large amount of culture needs using for protein purification, all are sucked out and transferred to a clean container); add XmL+75ul 8M urea solution to dissolve the sediment, and then suck 75ul.
8. Add 25ul 4×Loading buffer to the three tubes of 75ul sample in steps (5) and (7); boil at 100℃ for 10min (note that heavy objects can be pressed above the pipe to prevent the cover from exploding).
Store the prepared whole bacteria, soluble and inclusion body protein samples at -20℃ or directly use them for SDS-PAGE or Western blot experiments (see general protocol for experimental steps).
Part 3 Purification of soluble scFv protein
We expressed scFv with 6×Histidine tag in prokaryotic , so Ni-column affinity chromatography is used for purification.
1. Mix the Ni-Agarose Resin and add it to the chromatographic column and stand for 10 minutes at room temperature until the gel is separated from the solution. Open the liquid outlet at the bottom and let the ethanol flow out slowly by gravity.
2. Add 5 times the column volume of deionized water to the packed column, ish the ethanol, and then balance the column with 10 times the column volume of soluble binding buffer (10mm imidazole, 20mm Tris HCl, pH = 7.9, 0.5m NaCl). The sample can be loaded after balancing.
3. After the bacteria are collected, the bacteria are lysed by ultrasound until the bacterial solution is clarified. (note that protease inhibitors need to be added and the ultrasonic process is always in ice bath. Be sure to prevent temperature rise sharply or a large number of bubbles from causing denaturation and inactivation of soluble protein)
4. The soluble protein in the supernatant is collected by centrifugation at 13000 rpm and 4℃ for 10 minutes.
5. The bacterial lysate is diluted equally with soluble binding buffer, loaded on the column, the flow rate is 10 times the column volume/hour, and the flow-through solution is collected.
6. Rinse the column with a solid binding buffer 15 times the column volume to ish away the miscellaneous proteins.
7. Elute with an appropriate amount of solution solution buffer, and collect 1ml per tube.
8. After elution, the column is finished with deionized water 10 times the column volume, and then balanced with 20% ethanol 3 times the column volume. (the filler shall be immersed in ethanol) and stored at 2-8℃ after column sealing)
9. Take an appropriate amount of each sample in the purification process, add protein loading buffer and boil it at 100 ℃ for 10min for subsequent SDS-PAGE and Coomassie brilliant blue staining to analyze the purification effect.
10. Select scFv protein with high purity and concentration (if necessary, desalting and concentrating can be carried out with dialysis bag or ultrafiltration tube. See their instructions for the method); add 100% sterile glycerol of equal volume, and store it at - 20℃.
Part 4 Protein concentration determination
Considering that our protein sample is not very pure, we did not choose BCA protein concentration quantitative method to determine the concentration of scFv in the purified sample, but SDS-PAGE and Coomassie brilliant blue staining method.
1. Prepare standard concentration protein samples and purified scFv samples to be measured: dilute His-HRP protein with a purity of 90% of 0.8mg/ml into samples with his HRP concentrations of 400ug / ml, 200ug / ml, 100ug / ml, 50ug / ml, 25ug / ml and 12.5ug/ml, and prepare scFv purified samples. Add the protein loading buffer into the above samples and boil at 100℃ for 10min.
2. The above samples are stained with Coomassie brilliant blue after running SDS-PAGE.
3. Scan and take photograph.
4. Use Image J software to analyze the grayscale of the strip, make a standard curve, and calculate the scFv concentration in the purified sample.
Part 5 The activity of scFv is analyzed by Western blot
1. Detection of recombinant human GPC3 (rHGPC3) antigen by Western blot: firstly, prepare the protein sample of rHGPC3, add the protein loading buffer and boil at 100 ℃ for 10 min. Run SDS-PAGE(60V, 80V); conduct transmembrane (300mA, 1H); block with 5% BSA for 1h (Note: do not use skimmed milk powder, our experiment shows that scFv may bind to a protein in skimmed milk powder, resulting in negative results); purified scFv protein samples are diluted 200 times with 5% BSA and incubated with PVDF membrane at 4℃ overnight; ish for 3 times with TBST times; anti-His antibody is incubated at room temperature for 3h; ish for 3 times with TBST times; HRP conjugated secondary antibody is incubated at room temperature for 1h, and ish for 3 times with TBST; exposure and take photograph.
2. Detection of GPC3 antigen in HepG2 cells by a Western blot: first, prepare HepG2 cell lysate samples; When HepG cells in the six-well plate are full, 200 ul Cell lysis buffer is added; dissociate at a speed of 200rpm for 1h on a 4℃shaker; Add protein loading buffer and boil at 100℃ for 10min. Run SDS-PAGE(60V, 80V); conduct transmembrane (300mA, 1H); block with 5% BSA for 1h (Note: do not use skimmed milk powder, our experiment shows that scFv may bind to a protein in skimmed milk powder, resulting in negative results); purified scFv protein samples are diluted 200 times with 5% BSA and incubated with PVDF membrane at 4℃ overnight; ish for 3 times with TBST times; anti-His antibody is incubated at room temperature for 3h; ish for 3 times with TBST times; HRP conjugated secondary antibody is incubated at room temperature for 1h, and ish for 3 times with TBST; exposure and take photograph.
Part 6 Kd value of antibody is determined by enzyme-linked immunosorbent assay
1. HepG cells are inoculated into 24 well plates. Wait until the cell confluence reaches 100%.
2. Suck off the medium and ish once with 200ul PBS.
3. Add 200ul 4% paraformaldehyde to fix cells for 5min
4. Wash once with 200 ul PBS
5. For anti-GPC3 polyclonal antibody or scFv, add 1% BSA (prepared with PBS) and block at room temperature for 1h.
6. For scFv, scFv diluted to different concentrations with 1% BSA (prepared with PBS) is added and incubated at 4℃s overnight. ish for 3 times with PBS.
7. For polyclonal antibodies, PaAb diluted to different concentrations with 1% BSA (prepared with PBS) is added and incubated at room temperature for 3h. ish for 3 times with PBS.
8. For TLS11a, 5'-biotin labeled TLS11a of different concentrations prepared with PBS is added and incubated at room temperature for 2h. ish for 3 times with PBS.
9. For scFv, an anti-His antibody diluted by 1/1000 with 1% BSA is added and incubated at room temperature for 3h. ish for 3 times with PBS. Then add HRP-conjugated secondary antibody diluted with 1% BSA and incubate at room temperature for 1h. ish for 3 times with PBS.
10. For polyclonal antibody, HRP-conjugated secondary antibody diluted with 1% BSA is added and incubated at room temperature for 1h. ish for 3 times with PBS.
11. For TLS11a, streptavidin-HRP prepared by PBS is added and incubated at room temperature for 1h. ish for 3 times with PBS.
12. Add 200ul TMB chromogenic solution into each well and react at 37℃ for 15min. 200ul 2M HCl is added to terminate the reaction. The absorbance of 450 nm is measured by enzyme labeling instrument.
Part 7 Cellular immunofluorescence
1. Drop 10ul DMEM medium into 24 well plates, add special cell climbing sheet treated by TC, and inoculate HepG2 cells with a relatively low density.
2. After 48 hours, the cells adhered firmly to the sheet. Suck off the medium and ish it once with 200ul PBS.
3. Add 200ul 4% paraformaldehyde to fix for 5min.
4. Wash once with 200 ul PBS
5. For scFv, add 1% BSA (prepared with PBS) and block at room temperature for 1h. scFv diluted by 1/200 with 1% BSA is added and incubated at 4℃ overnight. ish for 3 times with PBS. Then add 1/1000 anti-His antibody diluted with 1% BSA and incubate at room temperature for 3h. ish for 3 times with PBS. Then FITC-conjugated secondary antibody diluted with 1% BSA is added and incubated in the dark at room temperature for 1h. Then dye with DAPI away from light for 2min and finished with PBS for 3 times. Take out the climbing slide, put it upside down on the glass slide dripping 3ul glycerol, observe and take photos with a confocal microscope.
6. For anti-GPC3 polyclonal antibody, 1% BSA (prepared with PBS) is added and blocked at room temperature for 1h. Polyclonal antibody diluted 1/1000 with 1% BSA is added and incubated at room temperature for 3h. ish for 3 times with PBS. Cy5-conjugated secondary antibody diluted with 1% BSA is added and incubated at room temperature in the dark for 1h. Then dye with DAPI away from light for 2min and ished with PBS for 3 times. Take out the climbing slide, put it upside down on the glass slide dripping 3ul glycerol, observe and take photos with a confocal microscope.
7. For TLS11a, 5'-Rox labeled TLS11a prepared with PBS is added and incubated at room temperature in the dark for 2h. ish for 3 times with PBS. Then dye with DAPI away from light for 2min and ished with PBS for 3 times. Take out the climbing slide, put it upside down on the glass slide dripping 3ul glycerol, observe and take photos with confocal microscope.
Part 8 Flow cytometry
1. When hepG2 cells of two 10cm dishes are full, they are digested with trypsin. Then centrifuge to collect all cells.
2. Wash twice with PBS, add 1.2ml PBS to suspension cells, divide them into 6 parts and add them into 6 EP tubes (each tube is 200ul).
3. 200ul of His-HRP (blank group) or His-scFv of 1.25ug/ml, 2.5ug/ml and 5ug/ml are added respectively and incubated at room temperature for 1h.
4. Washed with PBS for 3 times.
5. Add anti-His antibody(1/1000) and incubated at room temperature for 1h.
6. Washed with PBS for 3 times.
7. Add diluted FITC-conjugated secondary antibody and incubate at room temperature in the dark for 30 min.
8. Washed with PBS for 3 times.
9. Fluorescence analysis by flow cytometry.
Specific replication
Overview
The design of this part starts with the difference of miRNA between HCC cell (HEPG2 cell line) and normal cell (HEK293T cell line), and we designed specific virus gene with a corresponding target sequence in its 3’UTR. Based on the virus gene with special 3’UTR, we added the design of sponge to enlarge the difference of miRNA.
Therefore, we measured the difference of miRNA content in HepG2 cell line and HEK293T cell line, constructed eGFP-3’UTR and sponge plasmids, and tested the function of them with miRNA added or not.
Part 1 Design of E1A-3'UTR
To make the Viruguard to distinguish cancer cells from normal cells, we chose three different miRNAs which was said to have different content in HCC cells and normal cells as shown in Table. 3-1 and the detailed distribution of these miRNAs in differnt cell typeswere further confirmed by atlas of human miRNA in Fig. 3-1 [1-3].
| Name | Sequence |
|---|---|
| has-miR-22-5p | AGUUCUUCAGUGGCAAGCUUUA |
| hsa-miR-195-5p | UAGCAGCACAGAAAUAUUGGC |
| hsa-miR-199a-5p | CCCAGUGUUCAGACUACCUGUUC |
The miRNA195 and 199 were examined in the same way. We chose Hek293T cells as our comparison cell in later experiments because the kidney cells were predicted to have lower expression of these 3 kinds of miRNA compared with other normal cells.
After specific miRNAs were selected, how to insert each miRNA to 3’UTR of E1A became a problem. With the tool provided online, we obtained the reverse complementary of miRNA first and designed the spacer which separated each miRNA according to Saetrom’s study in Fig. 3-2, the binding affinity of miRNA to 3’UTR were also predicted [4,6].
Part 2 Design of miRNA sponge
3'UTR-E1A should have been efficient enough to slience the E1A, but could we make the Viruguard safer by increasing the difference of miRNA content between normal cells and HCC cells. Thus we decided to design a miRNA sponge like Fig. 3-4 which constitutes of tandem repeats of all three kinds of miRNAs to absorb free miRNA under the control of tumor specific promoter according to Kluiver’s manuscript [5].
The sponge is composed of several complementary tandem repeats of each miRNA flanking by two restriction enzyme sites.
The secondary structure and miRNA binding affinity of sponge were evaluated by RNA fold web server and miRNAsong to make sure the miRNA binding sites were exposed and it had strong attraction to free miRNA which was illustrated in Fig. 3-5 and Fig. 3-6 [5,6].
The green paired bases had relatively low binding affinity which would not affect the binding of miRNA while the red bases had tight binding. Both possible linear and circular structure were shown above.
It indicated that our miRNA sponge were likely to absorb the free miRNA in cytosol.
Part 3 Construction of 3’UTR, sponge, and null plasmid
p3UTR and pSp were generated by Genescript.
To eliminate the living burden put on cells by plasmid transfection, null plasmids for p3UTR and pSp were constructed by one step cloning kit for negative control.
Polymerase chain reaction was performed in PCR machine together with KOD high fidelity polymerase mixture including flanking primers (Null_1R & Null_1F) as shown in Fig. 3-7. The phosphate group was added to sticky ends of PCR product by catalysis of PNK enzyme which were then connected by T4 ligase overnight. The concentration of PCR products was measured by nanodrop. The successful construction of empty plasmid was confirmed by agarose electrophoresis with primers 3UTR-EMPTY-F and 3UTR-EMPTY-R in Fig. 3-7 as well. Null plasmids were then transformed to DH5α and inoculated to Amp(+) plate. After incubating at 37℃ overnight, single bacterial colony was picked and shaking in liquid LB medium for 6 hours. Colonial PCR was performed by Taq polymerase to further illustrate the correct construction of null plasmid, which was followed by second generation sequencing by genescript.
Primers Null_1R and Null_F are used to construct p3'Unull. Primers 3UTR-EMPTY-F and 3UTR-EMPTY-R are used to verify the successful construction of p3’Unull. Using p3UTR as an example here, the construction of pSp and pSp null are same with it.
Part 4 Construction of replenishment plasmid
shRNA 22,195, 199 short single chain fragments was purchased. Annealing was performed under the condition of gradient descending temperautre and the products was inserted to pRNAiU6 by digestion of speedy cut XhoI and HpaI under 37℃ for 30mins. PNK enzyme and T4 ligase were used for connection of ending nucleotide. The product (pRNAiU6.2-22, pRNAiU6.2-195, pRNAiU6.2-199a) was examined and processed in the same way with null plasmid.
Part 5 miRNAs content measurement
Firstly, we chose miR-199a, miR-195, miR-22 from miRNA which had higher expression in normal cells than HCC cells among miR-195, miR-199a, miR-200a, miR-125a, miR-191, miR-22 and etc [1,2].
Then we used Bulge-Loop primer set from Ribobio to detect miRNA expression and differential analysis based on qPCR detection technology, and we chose U6-1 as our internal reference which was a component of splicing complex. The design of our experiment was illustrated in Table. 3-2.
Part 6 Transfection of selected plasmids to HepG2 and Hek293T
p3UTR, pSp and their empty plasmids were transformed to BL21Plasmids were extracted by endofree plasmid midi kit after shaking overnight. The concentration of plasmid extracted was measured by nanodrop.
We placed HepG2 and Hek293T cells per well in 100μL of complete growth medium 12-24 hours prior to transfection. At the time of transfection, the confluency of cells were 70%-90% to ensure the transfection efficacy. In order to examine the function of E1A-3'UTR, HepG2 and Hek293T were transfected with 3’UTR-pcDNA3.1-N-eGFP, 3’UTRempty-pcDNA3.1-N-eGFP (p3U and p3Unull, 3Unull also called 3Uempty or 3ue here). After 24h, we use the microplate reader to detect the intensity of fluorescence. Living cell count were determined by CCK8, the absorption of which at 450nm indicated the number of living cell. The fluorescence microscope was used to capture the cells at 4× and 10× (objective) for three dark visions and three bright ones each well.
We also designed plasmids called pRNAiU6.2-22, pRNAiU6.2-195, pRNAiU6.2-199a to increase the quantity of these miRNA in HepG2 as described previously. That was how we could know if the effect of 3UTR was actually caused by miRNA or other variables. Thus, we transfected 3u and one of these plasmids above into HepG2. The group called 3u+u6 was the controlled group, and u6 referred to pRNAiU6 without extra part.
As for sponges, the cells were also transfected with the sponge-pcDNA3.1-P2A-C and 3’UTR-pcDNA3.1-N-eGFP at the same time. To figure out the proper ratio of these two types of plasmids, we also tried to transfect different ratios of plasmid, the result of which indicated the optimized design of the final virus. The quantity sum of the plasmids transfected were controlled as the same. The processing of plate stayed the same with what we did in 3U transfection. Other details about the arrangements of transfection are shown in the following supplementary materials.
The exampled experiment were shown below in Fig. 3-8.
We provide some supplementary materials.
Oncolytic Virulence
Part 1 shRNA expression plasmid
(1) shRNA sequences acquisition
With the help of thermofisher online shRNA design tools, BLOCK-iT™ RNAi Designer[8], we are going to find the key sequences in our targeting genes for RNAi.
(2) Plasmid construction
1. shRNA annealing
After loading single-stranded shDNA into PCR tube, it will be heated to 95℃ then cooled by a gradient to 24℃ to get dsDNA. The temperature gradient: 37℃ 30min; 95℃ 5min; 95℃ 10s; 85℃ 30s; 75℃ 30s; 60℃ 15s; 55℃ 15s; 50℃ 15s; 45℃ 30s; 35℃ 15s; 24℃ 15s; 12℃ forever for storage temporarily.
2. Plasmid linearization
We use specific restriction endonuclease ( XhoI and HpaI ) to cut the plasmid so that it will have the same sticky ends as what we designed in shRNA. The detail of digestion experiment please see the supplementary file. Agarose gel electrophoresis is used to verify the success of linearization.
3. Connection
We use T4-ligase to link shDNA to the linearized plasmid. The reaction mixture will be incubated at 22℃ for ten minutes to achieve maximum bonding efficiency. Then the constructed plasmid will be transformed into DH5α bacteria. The transformed bacteria will be inoculated on kanamycin resistant medium. Then the growing colony will be used to carry on colony PCR and agarose gel electrophoresis to ensure the connection is successful. Finally we send the bacteria colony to the company for sequencing.
Part 2 Effects of shRNA on cancer cell survival related genes
The designed shRNA will be processed in the nucleic of the cell and then interfere with the targeting gene through the RNAi mechanism. We want to explore the efficiency on transcription silence of our designed shRNA sequence and see whether it will cause translation suppression and greater cell apoptosis. So we are going to verify the design from a different stage of the gene expression.
Firstly, we will use a direct way to see how our mechanism will influence the survival of the cell. HepG2 cells were planted in six-hole plate one day before transfection and after 24h or 48h, they are collected. By using the Annexin-V FITC/PI method, we stained the apoptosis cells into red and by checking the intensity of the fluorescence, we were able to calculate the relative dead rate of the cell.
Next, we decide to make sure shRNA is able to reduce the mRNA level of VEGFA and hTERT. HepG2 cells were planted in six-hole plate one day before transfection and after 24h or 48h, they are collected. Then we use the qRT-PCR to see after two days of transfection, how the transcription level will be influenced.
| Group | Time | Dose of shRNA plasmid |
|---|---|---|
| Blank | 24,48h | 0 |
| GADPH | 24,48h | 1,2mg |
| Scramble | 24,48h | 1,2mg |
| hTERT-1,2,3(Three individual holes) | 24,48h | 1,2mg |
| VEGFA-1,2,3(Three individual holes) | 24,48h | 1,2mg |
Finally, we are going to see how the protein expression changes along with the transfection of shRNA plasmids. We collected the cell cultivated in six-hole plate and extracted their protein after one, two or three days of transfection and then conducted the Western Blotting to check the expression level of the protein.
| Group | Time | Dose of shRNA plasmid |
|---|---|---|
| Blank | 24,48,72h | 0 |
| GADPH | 24,48,72h | 1,2mg |
| Scramble | 24,48,72h | 1,2mg |
| hTERT-1,2,3(Three individual holes) | 24,48,72h | 1,2mg |
| VEGFA-1,2,3(Three individual holes) | 24,48,72h | 1,2mg |
Part 3 Specific expression promoter
Next, we are going to examine whether the specific expression promoter work as our expectation. By transfecting the survivin-EGFP or htert-EGFP plasmid into cancer cell lines HepG2 and normal cell line, we decide to show the expression difference by calculating the green fluorescence intensity of different groups.
| Cell type | Time | Type of promoter |
|---|---|---|
| Hek293T | 24,48h | survivin,htert |
| HepG2 | 24,48h | survivin,htert |
Recombinant adenovirus experiment
After verifying that each part of the design meets our assumptions, we need to detect the actual effect of virus guard from the virus level, so we need to do some virus experiments. Here is our plan for virus experiment.
Part 1 Determination of virus infection and replication ability in normal hepatocyte Lo2 and hepatoma cell HepG2
We can characterize the infection and replication ability of the virus by measuring the titer or MOI of the virus to two cells.
(1) Determination of virus titer
a. On the day before infection, two six well plates (5 per well) were inserted×105 cells) were inoculated into HepG2 and LO2 cells, respectively.
b. 24 hours after inoculation, we counted HepG2 and LO2 cells in six wells using the blood cell counting plate method to determine the actual number of cells.
c. The remaining holes are used to inoculate the virus.
d. After 20 hours of infection, change to dnaasei fresh medium, digest the residual plasmid DNA at 37 ℃ for 15 minutes, and then change to 2ml normal medium for 48 hours.
e. DNA extraction, virus quantification.
(2) Virus MOI assay
a. The day before infection was inoculated, so that the cell confluence was 30-40% the next day.
b. Set infection groups with different MOI values, such as infection groups of 1, 2, 5, 10, 20, 50, 100, and make two holes respectively.
c. After 12-24 hours, discard the culture supernatant, remove the virus without infected cells, and replace with fresh culture medium.
d. After 3-4 days of infection, the cells can be observed under a fluorescence microscope. The cells will be infected and express fluorescence. The proportion of cell infection can be estimated visually by taking photos or calculated according to the number of pictures.
e. Genomic DNA can also be extracted from digested cells, and the proportion of integrated virus and cells can be obtained by quantitative PCR method introduced in titer determination. Note that if the infected animal cells need to use the internal reference genes of the corresponding species.
Part 2 Effect of virus infection on cell viability
The recombinant adenovirus infected LO2 normal hepatocytes and HepG2 hepatoma cells, respectively. Group settings are: A: LO2, B: LO2+virus, C: HepG2, D: HepG2+virus. Each group has three multiple holes. The cell viability was detected at 0h, 24h, 48h, 72h and 96h after infection. The detection method was CCK8 detection method, which was detected by flow cytometry or enzyme-labeling instrument.
Part 3 Determination of activation of immune response by virus
PBMC cells were infected with control adenovirus and recombinant adenovirus, with three replicates in each group. After 24 hours, the supernatants of the two groups were collected and the IFN-α in the supernatants was detected by ELISA.
GENERAL EXPERIMENT
We provide some supplementary materials of general experiment. Please see this File.
References
[1] Elhendawy, M., Abdul-Baki, E. A., Abd-Elsalam, S., Hagras, M. M., Zidan, A. A., Abdel-Naby, A. Y., ... & Abdou, S. (2020). MicroRNA signature in hepatocellular carcinoma patients: identification of potential markers. Molecular Biology Reports, 47(7), 4945-4953.
[2] Murakami, Y., Yasuda, T., Saigo, K., Urashima, T., Toyoda, H., Okanoue, T., & Shimotohno, K. (2006). Comprehensive analysis of microRNA expression patterns in hepatocellular carcinoma and non-tumorous tissues. Oncogene, 25(17), 2537-2545.
[3] De Rie, D., Abugessaisa, I., Alam, T., Arner, E., Arner, P., Ashoor, H., ... & De Hoon, M. J. (2017). An integrated expression atlas of miRNAs and their promoters in human and mouse. Nature biotechnology, 35(9), 872-878.
[4] Saetrom, P., Heale, B. S. E., Snøve, O., Aagaard, L., Alluin, J., & Rossi, J. J. (2007). Distance constraints between microRNA target sites dictate efficacy and cooperativity. Nucleic Acids Research, 35(7), 2333–2342.
[5] Kluiver, J., Slezak-Prochazka, I., Smigielska-Czepiel, K., Halsema, N., Kroesen, B. J., & van den Berg, A. (2012). Generation of miRNA sponge constructs. Methods, 58(2), 113-117.
[6] Barta, T., Peskova, L., & Hampl, A. (2016). miRNAsong: a web-based tool for generation and testing of miRNA sponge constructs in silico. Scientific reports, 6(1), 1-8.
[7] Gruber, A. R., Lorenz, R., Bernhart, S. H., Neuböck, R., & Hofacker, I. L. (2008). The vienna RNA websuite. Nucleic acids research, 36(suppl_2), W70-W74.
[8] http://rnaidesigner.thermofisher.com/rnaiexpress
FOLLOW US
