<!DOCTYPE html>
Results Supplement
Quantitative Result for H2 Aptamer
HR2 Aptamer sequence[1]:
5' -
GGGCCGTCGAACACGAGCATGGTGCGTGGACCTAGGATGACCTGAGTACTGTCC
- 3'
We did not perform any qualitative test on H2 Aptamer but instead performed quantitative test straight forward.
Figure 1 Quantitative test for H2 aptamer affinity. The curve is analyzed using the equation: $$Y=\frac{Bmax \times X}{(Kd +X)} + M \times X$$. The H2 aptamer did not show any specific binding against HER2. 2 Repeats were done and both results were normalized with 7 μ M value defined as 100% and 0.1 μM value defined as 0%
As shown in Figure 1. H2 aptamer did not show any specificity against HER2, thus we did not conduct further experiments on this aptamer. More trials of the H2 aptamer ELONA can be found in the Lab Notes.
Reference
- Niazi, J. H., Verma, S. K., Niazi, S., & Qureshi, A. (2015). In vitro HER2 protein-induced affinity dissociation of carbon nanotube-wrapped anti-HER2 aptamers for HER2 protein detection. The Analyst, 140(1), 243–249. https://doi.org/10.1039/c4an01665c