Team:SCUT-China/Experiment
Loading...
Molecular Cloning
Solution system for enzyme digestion(37℃,2h)
Solution system for enzyme ligation(reaction at 16℃ overnight)
Formula for calculating volume ratio of fragment and vector:
Reaction system for Overlap PCR:
(1) Amplification of fragments
(2) Assembly for fragment 1 and fragment 2
(3) Amplification for product of assembly
Purification for product of PCR:
Chose appropriate kit according to length of fragment:
1.15-1000bp: UNIQ-10 Spin Column Oligo DNA Purification Kit (Sangon)
2.>1Kb (>200bp): omega cycle-pure kit
I. UNIQ-10 Spin Column Oligo DNA Purification Kit (Sangon)
1. Add four times volume of anhydrous ethanol into wash solution (tick on the bottle after addition)
2. Add 500μL binding buffer and mix them thoroughly
3. Transfer the mixed solution into the Spin Column and leave to set for 2 minutes at room temperature (bring the nucleic acid into contact with membrane), and centrifuge at 8,000 rpm for 2 minutes, discard the flow-through.
4. Add 500 μL wash solution into the column and centrifuge at 10,000 rpm for 1 minutes.
5. Repeat step 4, discard the flow-through.
6. Centrifuge at 10,000 rpm for 2 minutes to dry the remaining ethanol completely.
7. Transfer the Spin Column into new clean 1.5 mL centrifuge tube, and add 30 μL ddH2O into the membrane (right to the center of the membrane), and leave it set for 5 minutes, and then centrifuge at 12,000 rpm for 1 minutes.
8. The DNA solution is stored at -20 ℃ for long term conservation.
II. Omega cycle-pure kit
Pre: Add anhydrous ethanol into the wash buffer (tick on the bottle after addition)
1. Calculate the volume of CB Buffer added according to the length of fragments. (1.5 mL centrifuge tube)
① Add 4-5 times the volume of PCR product of CP Buffer in most case.
② If the length of the fragment is shorter than 200bp, then 6 times the volume of PCR product of CP Buffer is required.
2. Add PCR product into corresponding volume of CP Buffer, mix the solution, centrifuge for short to collect liquid hangs on the centrifugal tube wall.
3. Put the Spin Column in the collection tube, transfer the mixed solution of step 2 into the Spin Column, and leave it set for 2 minutes; centrifuge at 14,000 rpm for 1 minute, and then discard the flow-through.
4. Add 700μL DNA wash buffer into the collection tube, and leave it set for 2 minutes; centrifuge at 14,000 rpm for 1 minute, and then discard the flow-through.
5. Repeat step 4.
6. Centrifuge at 14,000 rpm for 2 minutes to dry the remaining ethanol completely. (mark corresponding names for each collection tube finally used while centrifuging)
7. Transfer the Spin Column into 1.5 mL collection tube, leave it at high place for 5 minutes (promote the evaporation of ethanol).
8. Add 30-50 μL Elution Buffer or ddH2O into the center of the membrane, and leave it set for 2 minutes; centrifuge at 14,000 rpm for 1 minute.
9. The DNA solution is stored at -20 ℃ for long term conservation.
PCR amplification system and conditions
TongF：TAATAATGGTTTCTTAGTATGA Tm value=4×5+2×17=54℃
ARS213-1gRNA-R：GATCATTTATCTTTCACTGC Tm value=4×7+2×13=54℃
Template KpnI
TongR：ACTAAGAAACCATTATTATCAT Tm value=4×5+2×17=54℃
ARS213-1gRNA-F：AGGTCAATGTAAAAATGCCA Tm value=4×7+2×13=46℃
Template NheI
Efficiency of PrimerStar enzyme:10 s 1kb 72℃ 1 min
Measurement of DNA concentration:
Wash the equipment with ddH2O for 1-2 times, then set zero with ddH2O (deviation measured twice should be lower than 1.0). pipet each time 4ul of the sample for measurement.
Homologous recombination:
Ligation of two fragment is performed with Clon Express II recombination kit, reaction system and conditions are listed below (the volume of each fragment solution is 0.5 uL). After ligation, place the reaction tube on ice for 10 minutes to cool down, then transformation is ready to begin.
Agarose gel electrophoresis:
After PCR
1. Measure out 0.2g of agarose and add 1×TAE buffer.
2. Heat the solution until it becomes clear. Add appropriate amounts of DNA stain after it cools down to about 55℃.
3. Pour the solution to the mold with a comb.
4. Let it solidify for at least 20min.
5. Move the comb. Put the gel with the mold in the electrophoresis chamber with TAE buffer.
6. Add 1/6 6×Loading buffer to each DNA sample.
7. Pipet 4uL samples and DNA marker to wells.
8. Run for 20min at 120V.
Construct of Valencene synthesis cerevisiae
Preparation for SD media:
Component for SD media:
20g/L dextrose, 10×YNB (6.7 g/100 mL), 10×DO Supplement (0.62 g/100 mL), 100×(Tryptophan), 100×(Leucine), 100×(Uracil). Calculate and weigh according to the component, dilute the solution to 1× according to corresponding proportion when add amino acid, YNB and DO. glucose solution is prepared and sterilized separately. For solid medium making, add extra 2% (w/v) agarose powder.
Preparation of Competent Cells:
Competent cells will be made from S.cerevisiae BJ5464 with S.c. Easy Comp Transformation Kit.
full instructions are listed below:
(1)Single colony is selected and inoculated in 5 mL SD (lack tryptophan only) liquid medium, and cultured in shaker at 30℃ and 220 rpm overnight, until OD600 is between 3.0-5.0; (because the OD value generated by spectrophotometer is only convincing to be in the range of 0.2-0.9, therefore it requires necessary dilution to lower the excessive OD value);
(2)Transfer culture: culture the cells until OD600 reaches the expectation, transfer a certain amount of yeast solution (360ul+5ml) to another 5mL SD (lack tryptophan only) liquid medium, and make initial OD600 be in the range of 0.2-0.4 (it can be 0.4 if you are in a hurry), and culture at 30℃ and 220 rpm for 4-6 hours, until the OD600 is in the range of 0.8-1.0;
(3)Collection of yeast: take 1 mL transferred yeast solution to 1.5 mL centrifuge tube, centrifuge at 7,000 rpm for 3 minutes at room temperature, discard the supernatant.
(4)Wash the remaining culture: take 1mL Solution I (Wash solution) to resuspend the cells, centrifuge at 3,000 rcf for 3 minutes at room temperature, discard the supernatant.
(5)Make competent cells: take 200 μL Solution II (Lithium cation solution) to resuspend the cells, S.cerevisiae BJ5464, whcih are competent cells, take 20 μL competent cell solution to other 200 μL centrifuge tube, which can be used to transformation of the plasmid or store in -80 ℃ refrigerator for long term conservation.
Cryopreservation：
Add 60% glycerol and make the final concentration range from 15%~20%.
Add 300μl 60% glycerol to 900μl yeast solution and mix them thoroughly.
Add 250μl 60% glycerol to 750μl yeast solution and mix them thoroughly.
Store at -80℃ for long term conservation.
Transformation of Cas9 plasmid:
Pipet 20 μL competent yeast cells, add 500 ng Cas9 plasmid and 200 μL solution III to the cell solution on clean bench, vortex to mix. Culture the yeast at 30 ℃ for 1 hour, vortex the solution every 15 minutes. Then spread 200μL bacteria solution on SD-ΔTrp solid medium evenly, culture at 30 ℃ for 2-4 days. When single colonies have grown, pick one colony and inoculate it to SD-ΔTrp liquid medium. Then make competent S. cerevisiae BJ5464 with plasmid Cas9 as the method mentioned before.
Take one tube of competent S. cerevisiae cells transferred with plasmid Cas9, add 500 ng donor fragment and 500 ng gRNA plasmid, and 200 μL Solution III; place the tube in the 30 ℃ incubator for 1 hour and take out to vortex every 15 minutes; pipet 200 μL solution and spread on SD-ΔTrp-ΔUra solid medium, culture at 30 ℃ for 2-4 days. When the colonies have grown, pick one colony and perform colony PCR for verification.
Colony PCR system and conditions
Construct of Nootkatone synthase cerevisiae
Transformation of Cas9 plasmid:
Pipet 20 μL competent yeast cells, add 500 ng Cas9 plasmid and 200 μL solution III to the cell solution on clean bench, vortex to mix. Culture the yeast at 30 ℃ for 1 hour, vortex the solution every 15 minutes. Then spread 200μL bacteria solution on SD-ΔTrp solid medium evenly, culture at 30 ℃ for 2-4 days. When single colonies have grown, pick one colony and inoculate it to SD-ΔTrp liquid medium. Then make competent S. cerevisiae BJ5464 with plasmid Cas9 as the method mentioned before.
Preparation for SD(ΔTrp--ΔLeu-ΔUracil) media:
Component for SD media: 20g/L dextrose, 10×YNB (6.7 g/100 mL), 10×DO Supplement (0.62 g/100 mL). Calculate and weigh according to the component, dilute the solution to 1× according to corresponding proportion when add amino acid, YNB and DO. glucose solution is prepared and sterilized separately. For solid medium making, add extra 2% (w/v) agarose powder.
Preparation of Competent Cells:
Competent cells will be made from CEN.PK2-1Ca with S.c. Easy Comp Transformation Kit, full instructions are listed below:
(1) Single colony is selected and inoculated in 5 mL SD (lack tryptophan only) liquid medium, and cultured in shaker at 30℃ and 220 rpm overnight, until OD600 is between 3.0-5.0; (because the OD value generated by spectrophotometer is only convincing to be in the range of 0.2-0.9, therefore it requires necessary dilution to lower the excessive OD value);
(2) Transfer culture: culture the cells until OD600 reaches the expectation, transfer a certain amount of yeast solution (360ul+5ml) to another 5mL SD (lack tryptophan only) liquid medium, and make initial OD600 be in the range of 0.2-0.4 (it can be 0.4 if you are in a hurry), and culture at 30℃ and 220 rpm for 4-6 hours, until the OD600 is in the range of 0.8-1.0;
(3) Collection of yeast: take 1 mL transferred yeast solution to 1.5 mL centrifuge tube, centrifuge at 7,000 rpm for 3 minutes at room temperature, discard the supernatant;
(4) Wash the remaining culture: take 1mL Solution I (Wash solution) to resuspend the cells, centrifuge at 3,000 rcf for 3 minutes at room temperature, discard the supernatant;
(5) Make competent cells: take 200 μL Solution II (Lithium cation solution) to resuspend the cells, CEN.PK2-1Ca, whcih are competent cells, take 20 μL competent cell solution to other 200 μL centrifuge tube, which can be used to transformation of the plasmid or store in -80 ℃ refrigerator for long term conservation.
Cryopreservation:
Add 60% glycerol and make the final concentration range from 15%~20%.
Add 300μl 60% glycerol to 900μl yeast solution and mix them thoroughly.
Add 250μl 60% glycerol to 750μl yeast solution and mix them thoroughly.
Store at -80℃ for long term conservation.
Transformation of double plasmid to cerevisiae:
Pipet 20 μL competent yeast cells, add 500 ng of each plasmid Yep352-PpADH3-ADH1t-M8p-VS-SAG1t and YEp352-Hm6-HPO-TPI1t-CYC1p-AtCPR-CYC1t and 200 μL solution III to the cell solution on clean bench, vortex to mix. Culture the yeast at 30 ℃ for 1 hour, vortex the solution every 15 minutes. Then spread 200μL bacteria solution on SD-ΔTrp solid medium evenly, culture at 30 ℃ for 2-4 days. When single colonies have grown, pick one colony and inoculate it to SD-ΔTrp liquid medium. Then make competent CEN.PK2-1Ca with double plasmids as the method mentioned before.
Transformation of E.Coli:
Preparation for LB media:
(1) Component: 5g/L yeast extract, 10g/L NaCl, 10g/L tryptone. Calculate and weigh the mass of sample according to the media volume required, mix the solution completely, sterilize at 121 ℃ for 15 minutes. For solid medium making, add extra 20 g/L agarose powder. For LB medium with ampicillin, add extra ampicillin (100mg/mL) in the proportion of 1:1000.
(2) Ampicillin (100mg/mL): weigh 1.00g ampicillin, dissolve them in distilled water to make 10.00 mL, subpackage after filtration with 0.22 μm membrane in clean bench, stock at -20℃.
After acquiring the product of ligation, transform the DNA into E. coli DH5αcompetent cells with chemical method.
(1) Take a tube of competent cells (20 μL) out of -80 ℃ refrigerator and set on ice for 30 minutes to melt them. And add 10 μL ligation product into competent cells solution and flick the tube slightly to mix them up, then put them back on ice for about 30 minutes.
(2) Set competent cells with ligation system in water bath at 42 ℃ to heat shock for 90s (control the heating time precisely), and set the cells back on ice immediately and sit for 5 minutes. Add the competent cells into 800 μL LB medium (preheat to 37 ℃) that without selecting ability, and then culture the cells at 37 ℃ and 220 rpm for 1 hour for recovery.
(3) Take out the cells and centrifuge at 3,000 rpm for 3 minutes, and discard the 600 μL supernatant in the clean bench, resuspend the remaining bacteria, then pipet 200 μL bacteria solution and apply it on the LB solid medium with ampicillin evenly, culture the plate at 37 ℃ for 20-22 hours. When monoclonal cells grow on the plate, pick out one colony from it and isolate the cells by streak plate method on LB solid medium with ampicillin, continue culturing at 37 ℃ for a period (6 hours).
When the colonies on the plate have grown, positively select the monoclonal cells by colony PCR, pick 5-10 single colonies and dissolve them in 20 μL（ddH2O, for E.Coli)(NaOH, for yeast) in the clean bench, lyse the cells at 95 ℃ for 10 minutes, and centrifuge at 14,000 rpm for 5 minutes, templates for colony PCR are dissolved in the supernatant.
Colony PCR of E.Coli
After PCR, verify the length of PCR product by agarose gel electrophoresis, select the possible positive colony according to the results of electrophoresis, and inoculate the selected colony in LB/Amp+ liquid medium, culture at 37 ℃ and 220 rpm overnight, recombinated plasmid in bacteria is extracted by Mini Plasmid kit, sent to Sangon (Shanghai) to undergo genetic sequencing.
Analyse the results of sequencing with NCBI BLAST tools or Snapgene, stock the selected colony with correct DNA sequence, pipet appropriate amount of bacteria solution to tubes, and add appropriate glycerol (15% glycerol final), finally stock at -80 ℃.
Fermentation experimentation:
Fermentation of valencene:
Preparation for YPD media:
Component for YPD media : 10g/L yeast extract, 20g/L peptone, 20g/L dextrose. Calculate and weigh the mass of sample according to the media volume required, mix the yeast extract and peptone thoroughly, sterilize at 121 ℃ for 15 minutes, glucose solution is prepared and sterilized separately. For solid medium making, add extra 2% (w/v) agarose powder.
Fermentation experiment:
1. Select correctly verified single colony and inoculate it in YPD medium, culture at 30 and 220rpm overnight. Transfer the colony to another 10 mL YPD liquid medium (maintain the initial OD600 be at 0.05) when the solution OD600 is 3.5. And add 2 mL n-dodecane cover on the surface of fermentation broth, culture at 30 ℃ and 220rpm for 48 hours, conduct 3 parallel experiments for each sample.
2. Take out the conical flasks after 48 hours, pipet 1 mL organic phase on the top layer to centrifuge tubes, centrifuge at 12,000 rpm for 5 minutes. Pipet 500 μL ethyl acetate, vortex to mix thoroughly. Suck them out with syringe and filter the liquid to clean gas bottle with 0.22 μm filter.
Fermentation of nootkatone:
Preparation for SD media:
Component for SD media: 20g/L dextrose, 10×YNB (6.7 g/100 mL), 10×DO Supplement (0.62 g/100 mL), 100×(Tryptophan), 100×(Leucine), 100×(Uracil). Calculate and weigh according to the component, dilute the solution to 1× according to corresponding proportion when add amino acid, YNB and DO. glucose solution is prepared and sterilized separately. For solid medium making, add extra 2% (w/v) agarose powder.
Preparation for YPD media:
Component for YPD media : 10g/L yeast extract, 20g/L peptone, 20g/L dextrose. Calculate and weigh the mass of sample according to the media volume required, mix the yeast extract and peptone thoroughly, sterilize at 121 ℃ for 15 minutes, glucose solution is prepared and sterilized separately. For solid medium making, add extra 2% (w/v) agarose powder.
Fermentation experiment:
Select correctly verified single colony and inoculate it in YPD medium, culture at 30 and 200rpm overnight. Transfer the colony to another 10 mL YPD liquid medium (maintain the initial OD600 be at 0.05) when the solution OD600 is 3.5. And add 2 mL n-dodecane cover on the surface of fermentation broth, culture at 30 ℃ and 200rpm for 96 hours, conduct 3 parallel experiments for each sample.
Take out the conical flasks after 96 hours, pipet 1 mL organic phase on the top layer to centrifuge tubes, centrifuge at 12,000 rpm for 5 minutes. Pipet 500 μL ethyl acetate, vortex to mix thoroughly. Suck them out with syringe and filter the liquid to clean gas bottle with 0.22 μm filter.