Team:NTHU Taiwan/Results
Cloning
We used binary vector pBI121 to construct E. coli and A. tumefaciens. Short-hairpin RNA (shRNA) were designed according to Invitrogen Block-iT RNAi Designer. Therefore, we utilized two primers annealed as target genes aiming to encode shRNA. Since DNA ligation must have phosphate on 5'nucleotides. T4 Polynucleotide Kinase was used to phosphorylate the 5'nucleotides of primers. For plasmid digestion, Sac1 and Xba1 as restriction enzymes, target genes were inserted into pBI121. Besides, we performed gel extraction to prevent self ligation. With CaMV 35S promoter, shRNA could be constitutively expressed in pine trees. Our transformation outcome indicated that shRNA were successfully cloned into plasmid.
Fig.1-1 oligonucleotides annealing and function
| BXPEL | |
| TCTAGAGGAAAGCTCTATCGTTCTTGCCGAAGCAAGAACGATAGAGCTTTCC | |
| GAGCTCGGAAAGCTCTATCGTTCTTGCTTCGGCAAGAACGATAGAGCTTTCC | |
| PRX | |
| TCTAGAGGAATCGCTTTCCGTGGTTTGCGAACAAACCACGGAAAGCGATTCC | |
| GAGCTCGGAATCGCTTTCCGTGGTTTGTTCGCAAACCACGGAAAGCGATTCC |
Table1. shRNA sequence
Fig.1-2
We also conducted Agrobacterium transformation. Unfortunately, since time was limited, we didn’t select the right colonies of E.coli. The plasmid which we transformed didn’t compose of our target genes. However, the transformation outcome showed that we were able to do further experiments.
Fig. 1-3 Agrobacterium transformation outcome. LB4404 strains with plasmid were able to grow on YM medium with kanamycin and streptomycin.
Culturing Bursaphelenchus xylophilus
We contacted Prof. Jiue-in Yang to get B. xylophilus. On June 17,2021, we received the tubes that contained B. xylophilus and Alternaria citri, the food for B. xylophilus and we started to subculture them. But unfortunately, after two weeks, the tubes of A. citri we subcultured didn’t grow well. So we contacted Prof. Jiue-in Yang’s student--Mrs.Lu to get some useful opinions. With her help, we got a more successful result in the subculture this time. However, the A. citri still seems fewer and more gray than those in the tube that Mrs.Lu gave us .So we went to visit Prof. Jiue-in Yang’s lab in NTU. After we visited Prof. Jiue-in Yang’s lab in NTU, we made sure that the way we did our experiment didn’t go wrong. So there may be other reasons that affect our experiment, like: the environment of the lab or the humidity in the Incubator. Therefore, we subcultured B. xylophilus and A. citri by using an alcohol lamp and alcohol to make sure that our experiment wouldn’t be polluted during the aseptic process. Finally, we are glad to say that we got a better result after doing our experiment in the sterilized area.
Culturing callus of Pinus armandii
We got 250 seeds of Pinus armandii from the Forestry Bureau, Council of Agriculture, Executive Yuan. We referred to these two papers [1,2] and started cultivation. We used MS (Murashige and Skoog medium) that contain 2,4-D, 6-BA, inositol, and sucrose to induct and culture embryogenic callus in suspension. The callus was cultured in the dark at 25℃ and after the callus was cultured for about 2 weeks, they would be transferred to a fresh medium to proliferate. Fig. 2-1 were callus that was cultured for 7 days, we can see the umbrella epicotyl and there were some white callus proliferating. After two weeks, the callus kept growing bigger (Fig.2-2). On the 17th day, some of the calli became tan but still kept growing(Fig.2-3).On the 19th day, we transferred the calli to a solid medium, to culture nematodes on the callus, and confirm the nematodes will uptake the callus(Fig.2-4).To culture nematodes on callus, we transferred callus to solid medium (Fig. 2-5)
Fig.2-1 Callus on day 7
Fig.2-2 Callus on day 14
Fig.2-3 Callus on day 17
Fig.2-4 Callus on day 19
Fig.2-5 Callus on solid medium
Inoculating B. xylophilus on callus
After three weeks of callus cultivation, we want to verify that nematodes could feed on the callus tissue and survive. Thus, we inoculated about 200 nematodes on 0.8g callus as an experiment group(Fig. 3-1). The negative control nematodes were inoculated only on MS medium without callus or food. After two days of co-culture, the nematode of the negative control died. In contrast, around the edge of the callus, we could still see living wiggling nematodes(Fig. 3-2). The experiment suggests that B. xylophilus can survive on the P. armandii callus. Although, there wasn’t enough time to examine the nematode gene expression changes with gene-modified callus. However, this result partially proves the feasibility of our experiment design.
Fig.3-1 Nematode surviving experiment
Fig.3-2 Left: dead nematode. Right: living nematode
Reference
[1]Liu, X. Z.; Liu, Z.; Yang, Y. M.; Zhang, H. Y. Production of Transgenic Pinus Armandii Plants Harbouring BtCryIII(A) Gene. Biol. Plant. 2010, 54 (4), 711–714.
[2] Caifeng Jia, Yue Li. Somatic Embryogenesis of Immature Embryos in Pinus armandii, Chinese Bulletin of Botan,2006, 23 (2): 186~191