Team:NTHU Taiwan/Parts
Overview
We created short and long hairpin structures to let plants express double strain RNA (dsRNA). The whole basic genes can be divided into three parts, which are sense, loop and antisense. Sense and antisense part will anneal after transcription. The loop provides space for the mRNA to bend. After mRNA hairpin structure completes, Dicer cuts the loop part and annealed mRNA, resulting in several siRNA.
Plasmid and essential parts
We used pHANNIBAL and pBI121 to complete our project. Both of them contain CaMV 35S constitutive promoters. However, terminators are different. pHANNIBAL contains OCS terminator, while pBI121 includes NOS terminator.
Parts
| Name | Description | Length |
|---|---|---|
| BBa_K3835000 | long hairpin for Prx gene | 2165 bp |
| BBa_K3835001 | long hairpin for BxPel gene | 2303 bp |
| BBa_K3835002 | long hairpin for Prx gene (short version) | 1485 bp |
| BBa_K3835003 | long hairpin for BxPel gene (short version) | 1485 bp | BBa_K3500002 | CaMV 35S constitutive promoter | 346 bp |
| BBa_K3835004 | OCS terminator | 707 bp |
| BBa_K1537031 | NOS terminator | 253 bp |
Table1. long hairpin sequence, promoter, and terminator
| BXPEL | |
| TCTAGAGGAAAGCTCTATCGTTCTTGCCGAAGCAAGAACGATAGAGCTTTCC | |
| GAGCTCGGAAAGCTCTATCGTTCTTGCTTCGGCAAGAACGATAGAGCTTTCC | |
| PRX | |
| TCTAGAGGAATCGCTTTCCGTGGTTTGCGAACAAACCACGGAAAGCGATTCC | |
| GAGCTCGGAATCGCTTTCCGTGGTTTGTTCGCAAACCACGGAAAGCGATTCC |
Table2. shRNA sequence