|
|
| Line 123: |
Line 123: |
| | <a class="anchorOffset" id="Overview"></a> | | <a class="anchorOffset" id="Overview"></a> |
| | <h1>MB ELONA</h1> | | <h1>MB ELONA</h1> |
| − | <p>MB-ELONA | + | <p>See our <a href="https://2021.igem.org/Team:GreatBay_SCIE/Protocol">protocol summary</a> for more information about the experiment.</p> |
| − | Materials
| + | <p>This assay employs Magnetic Beads, which is modified with -NH<sub>2</sub>. This method uses MB to localize proteins for the ligand to bind on. HER2 ECD solution is added to activated-MB, and incubated for 1hr. Then it is placed on a magnetic rack, and the supernatant is removed. It is washed several times to remove unbound protein and biotinylated aptamers of different concentrations are added to incubate with protein-coated MB. The MB is then washed again to remove unbound aptamer and HRP-conjugated streptavidin is added for incubation, followed by washing and the addition of TMB solution. At last, stopping solution is added after incubation. MB is removed from the resulting yellow solution(if positive) and can be tested for absorbance at OD450 under the microplate reader.</p> |
| − | - MB Coupling Kit for Sangon
| + | <p>We employed this method testing the binding affinity of HR2 aptamer(Figure 1).</p> |
| − | - 羧基磁珠 Magnetic Beads (-COOH)(500 nm)
| + | |
| − | - 活化缓冲液 Activation Buffer
| + | |
| − | - 偶联缓冲液 Coupling Buffer
| + | |
| − | - EDC
| + | |
| − | - Sulfo-NHS
| + | |
| − | - 封闭液 Blocking Buffer
| + | |
| − | - 保存液 Preservation Buffer
| + | |
| − | - Aptamer Modification: Biotin Labelling & Chemical Modification
| + | |
| − | - HER2 ECD Protein
| + | |
| − | - 可能需要多一点，论文参考0.5-10μg/mL
| + | |
| − | - [HER2 ELONA] 预实验5个Aptamer浓度*3+空白*3 = 18 孔
| + | |
| − | - [HER2 ELONA] 实验需要 3孔
| + | |
| − | - [HER2 pH] 实验需要5个pH浓度*3 = 15 孔
| + | |
| − | - 每孔需要100μL，如果按照0.5μg/mL算的话需要1.8μg
| + | |
| − | - 但是鉴于我们实验不一定成功，所以建议直接3倍量 5.4μg
| + | |
| − | - PBST (1*PBS + 0.1% Tween 20)
| + | |
| − | - PBS Buffer
| + | |
| − | - TMB Reagent
| + | |
| − | - Streptavidin-HRP
| + | |
| − | - Sulphuric Acid at 2M
| + | |
| − | [ ] Coating HER2 on Magnetic Beads
| + | |
| − | Coating Protein: HER2 ECD (from SinoBiological), CBS as mother liquid
| + | |
| − | Preparation
| + | |
| − | 1. Take X μL of magnetic beads in a clean EP tube, and swirl the magnetic beads with vortex mixer for 15 seconds.
| + | |
| − | Note: The binding capacity of magnetic beads is 10-100 μg of protein per 1 mg of magnetic beads, the amount of magnetic beads and protein should be calculated in advance.
| + | |
| − | 2. Place the EP tube on the magnetic separation frame for 30-60s so that the magnetic beads are fixed on the EP tube wall, then discard the supernatant. | + | |
| − | 3. Remove the EP tube from the magnetic frame, add 2x (MB volume) of activation buffer; mix thoroughly.
| + | |
| − | 4. Place the EP tube on the magnetic separation frame for 30-60s so that the magnetic beads are fixed on the EP tube wall, then discard the supernatant.
| + | |
| − | 5. Repeat steps 3-4 twice.
| + | |
| − | Coating:
| + | |
| − | Activation
| + | |
| − | 6. Prepare 50 mg/mL of EDC and 50 mg/mL of Sulfo-NHS using the activation buffer, respectively.
| + | |
| − | Note: EDC and Sulfo-NHS should be prepared when using, stored away from light, and kept in ice before use. Activating 1 ml of magnetic beads requires 25 mg of EDC and 25 mg of Sulf- NHS.
| + | |
| − | 7. Add 1.5x (MB volume) of activation buffer, 0.5x (MB volume) of EDC and 0.5x (MB volume) of Sulfo-NHS into the EP tube containing magnetic beads, mix well and incubate at room temperature for 15 min.
| + | |
| − | 8. Place the EP tube on the magnetic frame for 30-60s so that the magnetic beads are fixed on the EP tube wall, then remove the supernatant.
| + | |
| − | Coupling
| + | |
| − | 9. Take 2.5μg of protein and magnetic beads and mix thoroughly, mix 2x (MB volume) coupling buffer into the EP tube.
| + | |
| − | 10. Incubate on a rotator at room temperature for 90 min or 4 °C overnight.
| + | |
| − | 11. Place the EP tube on the magnetic rack for 30-60s so that the magnetic beads are fixed on the EP tube wall, then remove the supernatant.
| + | |
| − | Blocking
| + | |
| − | 12. Add 5x (MB volume) of blocking buffer to the EP tube, mix thoroughly and incubate on a rotator at room temperature for 30 min.
| + | |
| − | 13. Place the EP tube on the magnetic frame for 30-60s so that the magnetic beads are fixed on the EP tube wall, then remove the supernatant.
| + | |
| − | 14. Add 5x (MB volume) of blocking buffer to the EP tube, mix well and place the EP tube on the magnetic frame for 30-60s so that the magnetic beads are fixed on the EP tube wall, then remove the supernatant.
| + | |
| − | 15. Add 5x (MB volume) of preservation buffer to the EP tube, mix well and place it on the magnetic frame for 30-60s to fix the magnetic beads on the EP tube wall, then remove the supernatant.
| + | |
| − | 16. Repeat step 3-4 twice.
| + | |
| − | 17. Add 1x (MB volume) of preservation buffer to the EP tube, mix thoroughly and store at 2-8℃.
| + | |
| − | Note
| + | |
| − | 18. Calculate the amount of magnetic beads and protein in advance.
| + | |
| − | 19. EDC and Sulfo-NHS should be ready for use, kept away from light, and placed on ice before use.
| + | |
| − | 20. Buffers that contain primary amine (such as Tris and glycine) inhibit the binding of proteins to magnetic beads. If the protein is dissolved in primary amine-containing buffers, use dialysis or desalination to remove the interfering components in this buffer before coupling.
| + | |
| − | 21. The protein concentration of the reaction needs to be optimized. Too low of a protein concentration will cause the magnetic beads to cross-couple. For expensive antibodies, if the protein concentration is too low, other proteins (such as BSA) can be added to occupy the remaining active sites.
| + | |
| − | [ ] Binding of Aptamer with HER2 ECD
| + | |
| − | 22. Add 5μL of HER2-MB, swirl gently; Place it on Magnetic Separation Frame for 60s; remove the supernatant.
| + | |
| − | 23. Dilute Biotin-HER2-Apt to 0.75μM by using Binding Buffer (PBS+MgCl2). Place in 90°C metal bath for 5 min, then immediately place into ice for 15 min.
| + | |
| − | 24. Add 50 μL of diluted aptamer into 5 μL MB.
| + | |
| − | 25. Incubation at 37°C for 15min, swirl every 3 min, make sure the MB is in full contact with the solution; after 15min, remove the supernatant.
| + | |
| − | 26. Add 50μL PBST, swirl gently; and place the system on Frame for 60s; remove the supernatant. Repeat a total of 5 times.
| + | |
| − | 27. Add 100uL of 1/2000 diluted streptavidin-HRP, dilute with PBS.
| + | |
| − | 28. Incubation at 37°C for 15min, swirl every 3 min, make sure the MB is in fully contact with the solution; after 15min, remove the supernatant.
| + | |
| − | 29. Add 50μL PBST, swirl gently; and place the system on Frame for 60s; remove the supernatant. Repeat a total of 5 times.
| + | |
| − | [ ] Measurements Under Microplate Reader
| + | |
| − | 30. Mix two bottles of TMB reagent (Solution A & B) by a volume ratio of 1:1, vortex if needed.
| + | |
| − | 31. Add 50μL of TMB mixture to each tube
| + | |
| − | 32. Incubation in dark for 15min at 37°C
| + | |
| − | 33. Move the solution into 96-well plate, 75μL per well.
| + | |
| − | 34. Reaction stopped by the addition of stopping buffer(2M of H2SO4) 25 μL
| + | |
| − | 35. Fluorescence is measured by microplate reader at absorbance=450nm</p>
| + | |
| − | | + | |
| − | | + | |
| − | <p>The specificity part of our project relies on the specific binding between the aptamer and HER2 receptors. Obtaining quantitative results through our experiment would, first, allow us to know more information about the aptamer we are using, which helps us to better design later experiments. Secondly, we can use the data in our modeling to improve our design, such as the density of aptamer on the surface of nanoparticles. We tried out 2 types of aptamers (Nickname: H2<sup>[1]</sup> & HR2<sup>[2]</sup>) and synthesized these aptamers at Genscript. However, only HR2 aptamer yielded result.
| + | |
| − | </p> | + | |
| − | <div class="highlights">
| + | |
| − | <p>HR2 Aptamer sequence:<br>
| + | |
| − | 5' -<br>
| + | |
| − | AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTATA<br>
| + | |
| − | TGTATTTGGTTTTTGGCTCTCACAGACACACTACACACGCACA<br>
| + | |
| − | - 3'<br>
| + | |
| − | </p></div>
| + | |
| − | <p>We designed our experiment based on a sandwich ELISA kit which is an in vitro enzyme-linked immunosorbent assay for the quantitative measurement of human HER2 in serum, plasma, and cell culture supernatants. Our assay employs a well-plate with an antibody specific for human HER2 receptors coated on a 48/96-well plate. Recombinant Human HER2 standard is pipetted into the wells and is bound by the immobilized antibody. The wells are washed and a biotinylated HR2 aptamers antibody is added. After washing away unbound biotinylated HR2 aptamer, HRP-conjugated streptavidin is pipetted to the wells. The wells are again washed, a TMB substrate solution is added to the wells and color develops in proportion to the amount of HR2 aptamer bound. The Stopping Solution changes the color from blue to yellow, and the intensity of the color is measured at 450 nm. | + | |
| − | </p>
| + | |
| − | <p>
| + | |
| − | We evaluated the ELISA kit first, with the standard sample given. The results indicated that, when the concentration of coated HER2 protein was at 8ng/mL, it still has reactivity to the provided HRP-antibody conjugates (provided in the kit) with high effectiveness and sensitivity. Thus, we chose to use add 8ng/mL of Recombinant Human HER2 standard.
| + | |
| − | </p> | + | |
| | <center> | | <center> |
| − | <img src="https://static.igem.org/mediawiki/2021/6/6e/T--GreatBay_SCIE--Results_Figure_1_Standard_Test.png" width="70%"> | + | <img src="https://static.igem.org/mediawiki/2021/4/42/T--GreatBay_SCIE--MB-ELONA_Qualitative.png" width="80%"> |
| − | <div class="image_text"><strong>Figure 1. A standard sample test of the ELISA.</strong> At 8ng/mL, the result shows that the antibody already has a high level of specificity</div> | + | <div class="image_text">Figure 1 A qualitative test for the binding affinity of HR2 aptamer using MB-ELONA.</div> |
| | </center> | | </center> |
| − | | + | <p>As can be observed in the result, BSA-coated MB showed OD450 values of roughly 0.2 in both aptamer concentrations, proving that our aptamer did not bind to BSA protein; whereas HER2-coated MB showed an increase in OD450 value when aptamer concentration increased by 0.1 when aptamer concentration increased from 0.0 to 1.0 μm. This provided evidence that our aptamer does have some degree of affinity for HER2 protein. We also performed MB-ELONA with no protein-coated, this gave us insight on possible reasons for the lack of difference between the control and experiment groups. We also performed MB-ELONA with no-protein conjugated. This proves the validity of MB-ELONA, as aptamers bind non-specifically to MB, which means that proteins were actually coated onto MB.</p> |
| − | <p>First, we did a qualitative test for HR2 aptamer.We successfully measured the HR2 aptamer bind to HER2 protein with high specificity and sensitivity.</p> | + | |
| − | <center>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2021/4/4a/T--GreatBay_SCIE--ELONA_Qualitative.png" width="70%">
| + | |
| − | <div class="image_text"><strong>Figure 2. Qualitative test for aptamer affinity.</strong>Some degree of specificity for HER2 receptor is shown on HR2 aptamer</div>
| + | |
| − | </center>
| + | |
| − | <br>
| + | |
| − | <p>
| + | |
| − | The result gave us insight into the range of concentration we should choose for obtaining the exact Kd of the aptamer in the followed-up quantitative experiment.</p>
| + | |
| − | <p>Next, we evaluated the HER2 binding affinity of the aptamer quantitively. In order to improve the efficiency of the experiment, we modified the experimental process. Firstly, we further reduced the HER2 protein concentration used in the experiment to 4ng/mL. Secondly, we replaced biotinylated HR2 aptamer with FAM-labeled aptamer for convenience, because FAM can be detected sensitively and we can reduce the process at the same time. HER2 proteins were incubated with increasing concentrations of FAM-labeled aptamer and analyzed by spectrofluorometer. Using non-linear regression analysis, the Kd of the aptamer for binding with the HER2 protein was estimated to be 1.803 μM.
| + | |
| − | <br>
| + | |
| − | <center>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2021/6/6a/T--GreatBay_SCIE--ELONA_Quantitative.png" width="80%">
| + | |
| − | <div class="image_text"> <strong>Figure 3. A further quantitative test for aptamer affinity.</strong> The curve accounts for non-specific binding of aptamer on the bottom of the well plate, achieved through adding a paramater; the equation: $$Y=\frac{Bmax \times X}{(Kd +X)} + M \times X$$. The R<sup>2</sup> value for the curve is 0.9801 and Kd = 1.803 μM.</div>
| + | |
| − | </center>
| + | |
| − | <br>
| + | |
| − | <a class="anchorOffset" id="PCR"></a>
| + | |
| − | <h3>Limitations</h3>
| + | |
| − | | + | |
| − | <h2>Asymmetric PCR</h2>
| + | |
| − | <p>
| + | |
| − | After obtaining the binding affinity of HR2 Aptamer, we went on to design a pH-sensitive HR2 aptamer. Tumor cells up-regulate H<sup>+</sup>/Na<sup>+</sup> antiporters and have produce excessive amounts of lactate, which results in reducing their environmental pH<sup>[4]</sup>. Allowing aptamers to be pH-sensitive, and only binds to HER2 receptors when they are in a low pH environment could minimize the damage dealt to normal tissue cells.</p>
| + | |
| − | <center>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2021/a/ac/T--GreatBay_SCIE--Results_Figure_4._pHs.png" width=100%>
| + | |
| − | <div class="image_text">
| + | |
| − | <strong>Figure 4<sup>[5]</sup>.</strong> <u>(left)</u> The pH-sensitive extension is an ssDNA chain that can fold into a d8plex under high or normal pH, the ends of the ssDNA chain consists of aptamer (ATP aptamer is used in literature for demonstration) and a complementary chain that binds with the aptamer and inhibits its action. The duplex shape places the two ends together thus aptamer is inhibited by complementary strand. When the aptamer is placed in low pH solutions, protonation of the bases occurs and stabilizes C·G Hoogsteen base pairing, which folds the ssDNA chain into a triplex. The triplex shape separates the two ends so the aptamer functions normally. <u>(right)</u> only C·G Hoogsteen base pairing is stabilized by protonation, thus increasing the percentage of C·G Hoogsteen base pairing increases the sensitivity of the ssDNA chain to protonation. TAT60 is used in our design.
| + | |
| − | </div>
| + | |
| − | </center>
| + | |
| − | <p>
| + | |
| − | To enable pH-sensitive property of HR2 aptamer, a DNA strand has to be added to the original aptamer which would fold into different shapes, which inhibits HR2 aptamer under high pH and allows high affinity for HER2 receptor under low pH. However, the pH-sensitive extension would extend the aptamer to 145 bp, which exceeds the limit for chemical synthesis, and even if we managed to reduce the length, the price of synthesis would remain expensive. Thus, we performed asymmetric PCR<sup>[3]</sup> to synthesize ssDNA strand.
| + | |
| − | </p>
| + | |
| − | <p>
| + | |
| − | First, we designed primers to synthesize the template; PCR has been carried out to replicate the template using the Forward Template and Reverse Template(shown below), where they would overlap and allow the replication of 145bp long template. Then, asymmetric PCR(asPCR) is performed, forward and reverse primer ratio of 1:1 up to 100:1 is added respectively in different groups to synthesize ssDNA strand.
| + | |
| − | </p>
| + | |
| − | <div class="highlights"><p>
| + | |
| − | Asymmetric PCR differs from normal PCR in the system used. In asymmetric PCR, forward and reverse primers are added with different ratios. So, ssDNA strands will be produced as there will be more forward (or backward) strands than the other.
| + | |
| − | pH-sensitive HR2 sequence, composed of HR2 Aptamer, pH-sensitive DNA switch, and complementary strand:
| + | |
| − | <br>
| + | |
| − | 5' -<br>
| + | |
| − | AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTATA<br>
| + | |
| − | TGTATTTGGTTTTTGGCTCTCACAGACACACTACACACGCACA<br>
| + | |
| − | <br>
| + | |
| − | TTTTGAGGGAAAGAATCATTTCTT<br>
| + | |
| − | TCCCTATGTTTCCCTTTCTTTTTAA<br>
| + | |
| − | <br>
| + | |
| − | TTGGGCGGTT<br>
| + | |
| − | - 3'<br>
| + | |
| − | | + | |
| − | | + | |
| − | <table border="1">
| + | |
| − | <tr>
| + | |
| − | <th>Primer</th>
| + | |
| − | <th>5‘ to 3' Sequence</th>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Forward Template</td>
| + | |
| − | <td>AACCGCCCAAATCCCTAAGAGTCTGCACTTGTCATTTTGTA
| + | |
| − | TATGTATTTGGTTTTTGGCTCTCACAGACACACTACACACGC</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Forward Primer</td>
| + | |
| − | <td>AACCGCCCAAATCCCTAAGAG</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Reverse Template</td>
| + | |
| − | <td>AACCGCCCAATTAAAAAGAAAGGGAAACATAGGGAAAGAAA
| + | |
| − | TGATTCTTTCCCTCAAAATGTGCGTGTGTAGTGTGTCTGTGAG</td>
| + | |
| − | </tr>
| + | |
| − | <tr>
| + | |
| − | <td>Reverse Primer</td>
| + | |
| − | <td>AACCGCCCAATTAAAAAGAAAGGG</td>
| + | |
| − | </tr>
| + | |
| − |
| + | |
| − | </table>
| + | |
| − | <center>
| + | |
| − | <div class="image_text"><b>Table 1 Primers and sequence.</b> The PCR programme can be found in the protocol summary <a href="https://2021.igem.org/Team:GreatBay_SCIE/Protocol" target="_blank">here</a></div>
| + | |
| − | <br>
| + | |
| − | </center>
| + | |
| − | </p></div>
| + | |
| − | | + | |
| − | <center>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2021/d/d6/T--GreatBay_SCIE--Result_Gel_Image.jpg" width="80%">
| + | |
| − | <div class="image_text"> <strong>Figure 5. The agarose gel for assymmetic PCR.</strong> As shown in the picture, when the F : R primer ratio is above 1 : 1, a blurry new band appears above the orginal band, which is identified as ssDNA.</div>
| + | |
| − | </center>
| + | |
| − | | + | |
| − | <p>
| + | |
| − | Figure 5 is our result for asymmetric, as can be seen, an extra band of DNA appeared above the dsDNA band, which can be identified as ssDNA. We noticed that this is not concordant with our referenced literature<sup>[3]</sup>, as in the literature ssDNA ends up below the dsDNA bands. However, we are able to prove the validity of our experiment by repeating with ssDNA strands synthesized by Genscript, which was used previously in ELONA (Figure 6). The ssDNA strand is 86bp long, however, it lies above the 100bp long ladder band. Through this, we can be sure of our result that we have synthesized the ssDNA strand of the desired length, though, due to unknown reasons, its band appeared above dsDNA strands.
| + | |
| − | </p>
| + | |
| − | | + | |
| − | <center>
| + | |
| − | <img src="https://static.igem.org/mediawiki/2021/2/20/T--GreatBay_SCIE--Results_Figure6%2C_asPCR_Validity.png" width="60%">
| + | |
| − | <div class="image_text"> <strong>Figure 6. The agarose gel for company-synthesized ssDNA strands of 86bp</strong> As shown in the picture, ssDNA of 86bp lies about the 100bp ladder, due to unknown reasons.</div>
| + | |
| − | </center>
| + | |
| − | <a class="anchorOffset" id="Reference"></a>
| + | |
| − | </p>
| + | |
| − | <p>
| + | |
| − | Through asPCR, we were able to synthesize ssDNA strands which are our aptamers. Our next step is to buy FAM-modified primers to synthesize aptamers for the ELONA test of the pHs-HR2 aptamer. However, due to a lack of time and effort, we were unable to finish future experiments.
| + | |
| − | | + | |
| − | Our original plan includes a qualitative test for the affinity of our pH sensitive aptamer at 5 μM, under pH 6.5, 7.1 and 8.0 to verify our theory. Our <u>expected</u> result would be an decrease in affinity when changing from pH 6.5 to 8.0.
| + | |
| − | </p> | + | |
| − | <br>
| + | |
| − | <a class="anchorOffset" id="Reference"></a>
| + | |
| − | <h1 id="Reference">Reference</h1>
| + | |
| − | <ol start='' >
| + | |
| − | <li>Niazi, J. H., Verma, S. K., Niazi, S., & Qureshi, A. (2015). In vitro HER2 protein-induced affinity dissociation of carbon nanotube-wrapped anti-HER2 aptamers for HER2 protein detection. The Analyst, 140(1), 243–249. <a href='https://doi.org/10.1039/c4an01665c' target='_blank' class='url'>https://doi.org/10.1039/c4an01665c</a></li>
| + | |
| − | <li>Liu, Z., Duan, J. H., Song, Y. M., Ma, J., Wang, F. D., Lu, X., & Yang, X. D. (2012). Novel HER2 aptamer selectively delivers cytotoxic drug to HER2-positive breast cancer cells in vitro. Journal of translational medicine, 10, 148. <a href='https://doi.org/10.1186/1479-5876-10-148' target='_blank' class='url'>https://doi.org/10.1186/1479-5876-10-148</a></li>
| + | |
| − | <li>Marimuthu C, Thean-Hock Tang, Soo-Choon Tan, Chee-Hock Hoe, Rajan Saini, Junji Tominaga and Subash C.B. Gopinath songklanakarin J. Sci. Technol. 34 (2), 125-131, Mar. - Apr. 2012</li>
| + | |
| − | <li>Tannock, I. F., & Rotin, D. (1989). Acid pH in tumors and its potential for therapeutic exploitation. Cancer research, 49(16), 4373–4384.</li>
| + | |
| − | <li>Thompson, I., Zheng, L., Eisenstein, M., & Soh, H. T. (2020). Rational design of aptamer switches with programmable pH response. Nature communications, 11(1), 2946. https://doi.org/10.1038/s41467-020-16808-2</li>
| + | |
| − | </ol>
| + | |
| − | <br>
| + | |
| − | <br>
| + | |
| | </div> | | </div> |
| | <script type="text/javascript" src="https://2021.igem.org/wiki/index.php?title=Template:GreatBay_SCIE/JS/sidebar&action=raw&ctype=text/javascript"></script> | | <script type="text/javascript" src="https://2021.igem.org/wiki/index.php?title=Template:GreatBay_SCIE/JS/sidebar&action=raw&ctype=text/javascript"></script> |
| | </body> | | </body> |
| | </html> | | </html> |
