Team:ZJUT-China/Improve
Two existing BioBricks have been improved this year, one is endowed with a new function, and the other has its expression enhanced.
For the gold medal criteria Improved Part, we improved the function of two different BioBricks: BBa_K337028 and BBa_K2205002. The improved versions of the parts can be found here: BBa_K3885126 and BBa_K3885311.
To ensure the normal operation of the Cell-Free system, an adjustable protein degradation mechanism is crucial. It is degraded by ClpXP AAA+ protease in Escherichia coli [1][2]. The protein must contain a degradation tag in order to be recognized by our Cell-Free system [3].
As the improvement of the IGEM10_Heidelberg registered part (BBa_K337028: tet Repressor), the degradation tag ssrA is added to the 3' end of the tetR (Figure 1), hence the newly registered part BBa_K3885126.
Figure 1. Schematic of hydrolysis by ClpXP protein.
In the cascade of gene circuits [4], we tested the ssrA degradation tag with ClpXP protein [3], to ensure tet Repressor was hydrolyzed (Figure 2).
Figure 2. Schematic of gene circuits and kinetics of tetR inhibition in the Cell-Free system.
(A) The gene circuits contains three parts, σ28 activates promoter P28 to express tet repressor with ssrA tag, which inhibits the expression of deGFP.
(B) The gene circuits contains an additional part P70-ClpXP that makes the tetR repressor degrade, and deGFP expresses.
(C) Group 1 carried tetR without ssrA and ClpXP; Group 2 carried tetR with ssrA; Group 3 didn't carry tetR as positive control; Group 4 carried tetR with ssrA and ClpXP in comparison with Group 1.
In Figure 2. C, the highest red line (Group 3) contains only P70a-σ28 and P28-tetO-deGFP plasmids, thus expressing deGFP with high fluorescence intensity and serving as a positive control. The second highest purple line (Group 4) with P70a-ClpXP can degrade tetR repressor with ssrA tag, eliminate its inhibition of deGFP expression in downstream of the gene circuits, and increase fluorescence intensity. The green line at the bottom of Figure 2. C (Group 1) indicates that the tetR repressor without ssrA tag cannot be degraded by ClpXP protein, in contrast to Group 4, indicating that ssrA degradation tag is functional. The blue line (Group 2) is at the bottom of Figure 2. C showed low fluorescence intensity, which was used as a negative control to indicate that the addition of tag did not affect the inhibition of tetR.
Therefore, we gave the tetR a new function and improved this part.
The deGFP reporter gene is an important component of synthetic biology, and the expression level of this gene can indicate many interesting characteristics of an experiment, such as sensitivity, leakage, etc. DeGFP synthesis rate differs for the same element in different chassis.
Our team found the component J23100-deGFP (BBa_K2205002) registered by iGEM17_Newcastle in the Parts, but the synthesis rate of deGFP in the Cell-Free system was lower than that in a cell-based system.
As a result, according to promoters and RBS suitable for Cell-Free systems reported in literature [5], through experiments and modeling, we found the combination of promoter and RBS that best expresses deGFP, and we registered it as BBa_K3885311.
We improved the component in two methods, one was to replace the promoter, the other was to replace RBS.
We changed the promoter and measured the synthesis rate of deGFP with the different concentration of the plasmid (Figure 3).
P70a: GCATGCTGAGCTAACACCGTGCGTGTTGACAATTTTACCTCTGGCGGTGAT AATGGTTGCa
P70b: GCATGCTGAGCTAACACCGTGCGTGTTTACAATTTTACCTCTGGCGGTGAT AATGGTTGCa
P70c: GCATGCTGAGCTAACACCGTGCGTGTTGACAATTTTACCTCTGGCGGTGAT AAAGGTTGCa
Figure 3. Rates of deGFP synthesis in the Cell-Free system, compared with model predictions, for reactions containing one of 3 plasmids, including the combinations of promoters P70a, P70b and P70c with UTRs UTR1, UTR2 and UTR3, at various different plasmid concentrations.
The figure indicates that the intensity of promoter is P70a>P70b>P70c. The relative strength of UTR spans nearly two orders of magnitude.
We changed the RBS and measured the synthesis rate of deGFP with different concentration of the plasmid (Figure 4).
UTR1: GCTAGCAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATG
UTR2: GCTAGCAATAATTTTGTTTAACTTTAAGAAGGATATATACCATG
UTR3: GCTAGCAATAATTTTGTTTAACTTTAAGAAGGGGGTATACCATG
Figure 4. Rates of deGFP synthesis in the Cell-Free system, compared with model predictions, for reactions containing different UTRs with the same promoter, at various different plasmid concentrations.
The figure indicates that the intensity of UTR is UTR1>UTR2>UTR3. The relative strength of UTR spans nearly two orders of magnitude.
Finally, the kinetic curves of 9 different combinations of P70 and UTR were analyzed for 3 hours at a plasmid concentration of 5nM (Figure 5. A).
Figure 5. Kinetics of different combinations of P70 and UTR plasmids (5nM).
The figure above indicates that P70a-UTR1-deGFP is the best combination for deGFP expression in Cell-Free systems.
Among the 9 combinations, we tested the reaction endpoint of the plasmid J23100-deGFP and P70a-UTR1-deGFP, and it was found that the improved part had a fluorescence intensity that was four times higher than the original element (Figure 5. B).
Clearly, the component was improved.