Team:Linkoping Sweden/vectorsprimers
Vectors
In our project, we used three different plasmid vectors, namely, pEERM1, pEERM4 and pUC19. pUC19 provided the possibility for us to exploit blue-white screening for our clonings. Both pEERM1 and pEERM4 are knock-in vectors specific to Synechocystis sp. PCC 6803 but with different integration sites.
Figure 1. Photo taken from Benchling to illustrate a schematic layout of the pUC19 plasmid vector used for blue-white screening in our project.
Table 1. Vectors used by all team members in the wet-lab for cloning, colony screening and transformation.
| Name | Antibiotic resistance | Use | Depositing lab |
|---|---|---|---|
| pUC19 | Ampicillin | Cloning and colony screening | Joachim Messing |
| pEERM1 | Kanamycin | Neutral site I knock-in vector | Pia Lindberg |
| pEERM4 | Chloramphenicol | Neutral site II knock-in vector | Pia Lindberg |
Primers
Table 2.Primers designed by the Linköping iGEM team 2021, and used for amplification and sequencing of our parts.
| Name | Sequence (5’-3’) | Direction | Use |
|---|---|---|---|
| Prefix-f | tattaagccatgggaattcgcggccgcttctag | Forward | Construct amplification |
| Suffix-r | tactagtagcggccgctgcagtattcta | Reverse | Construct amplification |
| pUC19-f | ctgttgggacttcgctatta | Forward | Sequencing primer |
| pUC19-r | gagcgcaacgcaattaatgt | Reverse | Sequencing primer |
| pEERM1-f | ctacacagcccagaactatg | Forward | Sequencing primer |
| pEERM1-r | aaaggcccagtctttcgact | Reverse | Sequencing primer |
| pEERM4-f | atgacagatagtgggctaag | Forward | Sequencing primer |
| pEERM4-r | tgtgactctagtagagagcg | Reverse | Sequencing primer |
| CBD-f | gcaaactcgtggaactgtca | Forward | Sequencing primer |
| Halorhodopsin-f | ctggtacgctattagttgtg | Forward | Sequencing primer |
| Beta-carotene-f | tcgttactacactcgttggc | Forward | Sequencing primer |
| M13-f | gtaaaacgacggccag | Forward | Sequencing primer |
| M13-r | caggaaacagctatgac | Reverse | Sequencing primer |