Team:Linkoping Sweden/Parts
Summarized in the tables below are all the parts designed by our team, for our project. We created a part collection that regulates the ion transport between membranes and the environment of Synechocystis sp. PCC 6803. It also enables the separation of the bacteria from the desalinated water. Furthermore, we improved an existing BioBrick (BBa_K1073022) by exchanging its RBS region and adding a G-10 leader. Additionally, the page has a summary of primers and vectors used in our project. All the parts were ordered as cloned products in pUCIDT-Amp from IDT. However, their attempts of synthesizing the product were unsuccessful, leading to the new strategy to order the parts as linear DNA fragments from TwistBioscience. Consequently, the linear DNA fragments were attempted to be cloned into pUC19 plasmids by ourselves. We have documented our planned and executed experiments with these parts in detail on our design and engineeringpages. Unfortunately, due to time constraints, we were not able to obtain results on several of our parts. Nevertheless, on the improvement page, you can see what results we acquired from our improved part.
Basic Parts
Table 1. All basic parts that were designed for our project with the contribution of all team members. All team members worked with the parts in the wet-lab.
| Biobrick ID | Short name | Short description | Length |
|---|---|---|---|
| BBa_K3892000 | Beta-carotene 15,15'-dioxygenase | All-trans retinal generating enzyme from Natronomonas pharaonis | 1059 |
| BBa_K3892001 | Halorhodopsin | Light-activated anion pump derived from Natronomonas pharaonis | 879 |
| BBa_K3892002 | Linker-CBD | Carbohydrate binding domain with a C-terminal linker (CBDcipA) derived from Clostridium thermocellum | 498 |
| BBa_K3892003 | Slr1272 | S-layer protein derived from Synechocystis sp. PCC 6803 | 762 |
| BBa_K3892004 | MscL | Mechanosensitive ion channel from Synechocystis sp. PCC 6803 | 441 |
| BBa_K3892005 | Linker-GFP | Green fluorescence protein from Aequorea victoria | 732 |
| BBa_K3892006 | EforRed | Chromoprotein EforRed from Echinopora forskaliana | 687 |
| BBa_K3892007 | Channelrhodopsin | Light-activated cation channel derived from Chlamydomonas reinhardtii | 2217 |
| BBa_K3892008 | PpsbA2 | Native, strong constitutive promotor derived from Synechocystis sp. PCC 6803 | 38 |
| BBa_K3892009 | Spacer-RBS-Spacer | Ribosome binding site with spacers | 45 |
| BBa_K3892010 | G-10 leader and RBS | Based on BBa_K1758100, ribosome binding site; phage T7 gene 10 leader | 36 |
Composite Parts
Table 2. All composite parts that were designed for our project with the contribution of all team members. All team members worked with the parts in the wet-lab.
| Biobrick ID | Short name | Short description | Length |
|---|---|---|---|
| BBa_K3892011 | Beta-carotene 15,15'-dioxygenase-Linker-GFP | Beta-carotene splitting enzyme for all-trans-retinal production with attached Green fluorescent protein | 1883 |
| BBa_K3892012 | Halorhodopsin-Linker-GFP | Anion pump for inward transport of chloride ions with attached Green fluorescent protein | 1703 |
| BBa_K3892013 | Slr1272-CBD-Linker-GFP | Native slr1272 protein derived from Synechocystis sp. PCC 6803 and optimized carbohydrate-binding domain with a C-terminal linker (CBDcipA) and Green fluorescent protein for separation of bacteria from water | 2084 |
| BBa_K3892014 | MscL-Linker-GFP | Mechanosensitive cation channel for outward transport of ions with attached Green fluorescent protein | 1265 |
| BBa_K3892015 | Channelrhodopsin-Linker-GFP | Cation channel derived from Chlamydomonas reinhardtii for inward transport of sodium ions | 3041 |
| BBa_K3892016 | EforRed improved | Red chromoprotein with strong RBS | 758 |
Improved parts
Table 3. An improved version of the part BBa_K1073022, designed by the Uppsala iGEM team in 2012. The RBS region has been exchanged for the part BBa_K3892009 and the G-10 leader BBa_K3892010 has been added.
| Biobrick ID | Short name | Short description | Length |
|---|---|---|---|
| BBa_K3892016 | EforRed improved | Red chromoprotein with strong RBS | 758 |
Vectors
Table 4. Vectors that all team members used in the wet-lab for cloning, colony screening and transformation.
| Name | Antibiotic resistance | Use | Depositing lab |
|---|---|---|---|
| pUC19 | Ampicillin | Cloning and colony screening | Joachim Messing |
| pEERM1 | Kanamycin | Neutral site I knock-in vector | Pia Lindberg |
| pEERM4 | Chloramphenicol | Neutral site II knock-in vector | Pia Lindberg |
Primers
Table 5. Primers designed by Linköping iGEM team 2021, and used for amplification and sequencing of our parts.
| Name | Sequence (5’-3’) | Direction | Use |
|---|---|---|---|
| Prefix-f | tattaagccatgggaattcgcggccgcttctag | Forward | Construct amplification |
| Suffix-r | tactagtagcggccgctgcagtattcta | Reverse | Construct amplification |
| pUC19-f | ctgttgggacttcgctatta | Forward | Sequencing primer |
| pUC19-r | gagcgcaacgcaattaatgt | Reverse | Sequencing primer |
| pEERM1-f | ctacacagcccagaactatg | Forward | Sequencing primer |
| pEERM1-r | aaaggcccagtctttcgact | Reverse | Sequencing primer |
| pEERM4-f | atgacagatagtgggctaag | Forward | Sequencing primer |
| pEERM4-r | tgtgactctagtagagagcg | Reverse | Sequencing primer |
| CBD-f | gcaaactcgtggaactgtca | Forward | Sequencing primer |
| Halorhodopsin-f | ctggtacgctattagttgtg | Forward | Sequencing primer |
| Beta-carotene-f | tcgttactacactcgttggc | Forward | Sequencing primer |
| M13-f | gtaaaacgacggccag | Forward | Sequencing primer |
| M13-r | caggaaacagctatgac | Reverse | Sequencing primer |