Team:Leiden/Parts
<!DOCTYPE html>
Parts
Over the course of the year, we have been working hard to make a system for biocontainment. To this end, we have cloned several toxin-antitoxin (TA) systems into Escherichia coli with various promoter sequences. This was done by testing the lethality of these toxins and to make a start in building DOPL LOCK. Below, you will find an overview of all of our parts with their corresponding biobrick registry number. Additionally, the primers used in the PCRs we performed are listed below.
Composite parts
| Part | Registry number | Description | Length (bp) |
|---|---|---|---|
| p2547::mCherry | BBa_K3962339 | Constant expression of mCherry | 863 |
| pBAD::mCherry | BBa_K3962340 | Inducible expression of mCherry | 2038 |
| pBAD::HOK | BBa_K3962341 | Inducible expression of toxin HOK | 1480 |
| pBAD::CcdB | BBa_K3962342 | Inducible expression of toxin CcdB | 2001 |
| pBAD::RelE | BBa_K3962343 | Inducible expression of toxin RelE_ | 1630 |
| pBAD::MazF | BBa_K3962344 | Inducible expression of toxin MazF | 1663 |
| p21::CcdB | BBa_K3962347 | Constant expression of toxin CcdB | 826 |
| p21::RelE | BBa_K3962348 | Constant expression of toxin RelE | 1087 |
| pBAD::SOK | BBa_K3962351 | Inducible expression of antitoxin SOK | 1557 |
| pBAD::CcdA | BBa_K3962352 | Inducible expression of antitoxin CcdA | 1567 |
| pBAD::RelB | BBa_K3962353 | Inducible expression of antitoxin RelB | 1582 |
| pBAD::MazE | BBa_K3962354 | Inducible expression of antitoxin MazE | 1573 |
| p162::CcdA | BBa_K3962355 | Constant expression of antitoxin CcdA | 392 |
| p162::RelB | BBa_K3962356 | Constant expression of antitoxin RelB | 407 |
Primers
The primers below were used to clone the Anderson series promoters p21 (BBa_J23113) and p162 (BBa_J23117) upstream the toxin and antitoxin genes CcdB/A and RelE/B respectively. The reverse primer of all of these sequences is identical since it anneals to the biobrick suffix sequence. The forward primers anneals to the standard biobrick prefix, and contains the sequence for either the p21 or p162 promoter. Additionally, we added an extra BamHI restriction site to the left flank of the brick. This has been done so that it will be possible to check if multiple biobricks of this promoter have been inserted into a plasmid, since an extra band can be created by restricting with this enzyme.
| Description | Sequence |
|---|---|
| RelE_Forward | ATTATGAATTCTAGAGGATCCCTGATGGCTAGCTCAGTCCTAGGGATTATGCTAGCAAAGAGGAGAAATACTAGGTGAGCGAC |
| RelB_Forward | ATATTGAATTCTAGAGGATCCTTGACAGCTAGCTCAGTCCTAGGGATTGTGCTAGCAAAGAGGAGAAATACTAGATGGGTAGCATTAACC |
| ccdB_Forward | ATTATGAATTCTAGAGGATCCCTGATGGCTAGCTCAGTCCTAGGGATTATGCTAGCAAAGAGGAGAAATACTAGATGCAGTTTAAGGTTTACA |
| ccdA_Forward | ATATTGAATTCTAGAGGATCCTTGACAGCTAGCTCAGTCCTAGGGATTGTGCTAGCAAAGAGGAGAAATACTAGATGAAGCAGCG |
| suffix antitox_Reverse | CCTGCAGCGGCCGCTACTAGTA |
| suffix _Toxin_Reverse | CTGCAGCGGCCGCTACTAGTA |
