Team:Leiden/Experiments
<!DOCTYPE html>
Experiments
For building up DOPL LOCK, we designed and set up necessary experiments to demonstrate the proof-of-concept. In this page, you can find an overview of the experiment design and a summary of the experiments we performed.
Experimental design
Because the toxin:antitoxin ratio to maintain the balance state was hard to find in previous literature, we used a bottom-up approach to build up the DOPL LOCK system. We divided the experiments into three stages. The first stage of the experiments was focusing on the characterization of each part in the DOPL LOCK system. For the characterization of the origin of replication (Oris), we co-transformed Escherichia coli (E. coli) TOP10 with two plasmids containing different fluorescent protein expression cassettes. Based on the fluorescent intensity of the strains, the best compatible pair of Oris was selected. For the characterization of toxins, we cloned inducible promoters in front of the toxin genes and performed a toxicity assay by measuring the bacterial growth after expression of the toxins was induced. For the promoters, we ligated promoters with mCherry to measure their transcriptional activity. For the second stage, we aim to create a single toxin-antitoxin system (TA system) based on the characterization from the first stage. The single TA system contains constructs of inducible promoter::toxin and constitutive promoter::antitoxin on a single plasmid. It will be used to find the balanced expression level. In the final stage, two verified single TA systems can be assembled and the final version of DOPL LOCK can be achieved.
Figure 1: overview of DOPL LOCK system
Experiment 1: sfGFP-RFP swap
We swapped the sfGFP reporter cassette in the original JUMP plasmids (comprised of constitutive promoter BBa_J23100 and sfGFP gene) to a RFP reporter cassette (BBa_J04450). This experiment created a second collection of JUMP plasmids with different reporters, which enabled us to evaluate the behavior of the co-transformed plasmids. The gene swap was done based on restriction enzyme cloning. JUMP plasmids and pSB1A3-RFP were both restricted by PstI and EcoRI, providing us with the JUMP backbone and an RFP construct. Then, the restriction products were mixed with a backbones/constructs molar ratio of 1:3. The DNA ligase and the buffer were added to the mixture for the reaction. Finally the reactions were stopped by heat shock and the products were ready for the transformations.
Experiment 2: (Co-)transformation of sfGFP and RFP plasmids
Figure 2: Selection of Oris
Table 1: The plasmids and their constructs used in the co-transformation
| NAME | RESISTANCE | ORIGIN OF REPLICATION | INSERT | INCOMPATIBILITY GROUP | COPY NUMBER |
|---|---|---|---|---|---|
| pJUMP26 | Kanamycin | p15A | sfGFP | B | Medium/Low copy number |
| pJUMP27 | Kanamycin | pSC101 | sfGFP | C | Low copy number |
| pJUMP28 | Kanamycin | pUC | sfGFP | A | High copy number |
| pJUMP29 | Kanamycin | pBR322/ROB | sfGFP | A | Medium/High Copy number |
| pJUMP46 | Spectinomycin | p15A | RFP | B | Medium/Low copy number |
| pJUMP47 | Spectinomycin | pSC101 | RFP | C | Low copy number |
| pJUMP48 | Spectinomycin | pUC | RFP | A | High copy number |
| pJUMP49 | Spectinomycin | pBR322/ROB | RFP | A | Medium/High Copy number |
Both single- and co-transformations of JUMP plasmids were performed during our labtime. Detailed information of plasmids used in this experiment is shown in Table 1. Co-transformations were performed to test the compatibility of the different Oris on the different JUMP plasmids and therefore the stably maintenance of the plasmid (Figure 2). The sfGFP and RFP containing JUMP plasmids were co-transformed in the E.coli TOP10 strain. Co-transformations were performed by heat-shocking the sfGFP and RFP plasmids into TOP10 competent cells according to the co-transformation protocol. Next, the transformants are grown on sterile LB agar medium containing spectinomycin and kanamycin as a selection method. After successful transformation in E.coli, fluorescent markers were expressed and measured by plate reader assay. As a result, it was shown that the Oris p15A and pBR322/ROB were most suitable to express similar levels of protein (Results page).
Single-transformations were often used as a positive control during plate reader assays, containing only a sfGFP or RFP plasmid. TOP10 strain containing no plasmids was used as negative control. The same protocol was used for the co-transformation, but in this case, only one plasmid was added to the competent TOP10 cells.
Experiment 3: Biobrick ligation
Standardized parts and coding sequences needed for the DOPL LOCK system, including toxins, antitoxins, promoters, GFP, and mCherry were obtained as gBlocks from our sponsoring company Integrated DNA Technologies (IDT). The toxin gBlocks are double stranded DNA fragments that were cloned into the iGEM plasmids pSB1A3 and pSB1C3 by restriction enzyme cloning. The ligation was performed according to the Ligation of gBlock DNA into plasmids protocol by first diluting and digesting the gBlock DNA with EcoRI and PstI. Then, the digested gBlocks were ligated into the linearized pSB1A3 or pSB1C3 plasmids by EcoRI and PstI. We transformed these plasmids into DH5α strain to multiply their amounts. Ligating the gBlocks into both plasmids enables us to assemble composite parts that require the following experiments rapidly.
Experiment 4: 3A assembly
3A assembly was intensively used in our project to create constructs for the characterization of different parts. The assembly was performed according to the protocol in iGEM registry. The plasmid products of 3A assembly were transformed into E. coli and grown on plates with kanamycin or spectinomycin. Only the strain containing the correct construct could survive. They were transferred to liquid LB medium to be prepared for the measurement of the optical density or the fluorescent intensity.
We cloned a variety of promoters (the Anderson collection of constitutive promoters and inducible promoters) in front of the fluorescent protein/toxin/antitoxin genes. For the promoter characterization, we assembled plasmids of pJUMP49-pBAD::mCherry and pJUMP49-p2547::mCherry. To evaluate the TA system, we assembled pJUMP26-pBAD::ccdB, pJUMP26-pBAD::HOK, pJUMP26-pBAD::RelE and pJUMP26-pBAD::MazF.
For more information about these constructs, see Parts.
Experiment 5: Plate reader fluorescence assay
Figure 3: Selection of the promoters
We calibrated the inducible promoter pBAD (BBa_I0500) with the constitutive promoter BBa_J23100 (referred to as p2547 in the following) using plate reader measurements (TECAN spark) (Figure 3). By doing this, we can relate these two kinds of promoters and use them to regulate toxin-antitoxin gene expressions. The plasmids used in the calibration were pJUMP49-pBAD::mCherry, pJUMP49-p2547::mCherry, and pJUMP49-pBAD (see Parts page). These plasmids were created by 3A assembly and transformed to the E. coli TOP10 strain. A 96-well plate with a gradient of L-arabinose was prepared and strains containing correct constructs were added to the plates in triplicates (more details in Measurement page). After that, the 96-well plates were put in the plate reader. The temperature was maintained at 37 °C in the plate reader and the plate shaken at 120 rpm. Every 12 min the fluorescence and the optical density of each plate were measured for 10 h.
The plate reader was also used to evaluate the compatibility of Oris when co-transformed. The co-transformed cells were cultured overnight in LB-medium and pippeted to a 96-well plate in triplicates accordingly. Each overnight culture was continually diluted 5 times to another three wells. Then, the plate was put in the plate reader for a one-time measurement of fluorescence and optical density. The temperature and the shaking speed were the same as previously mentioned.
Experiment 6: Toxicity assay in liquid medium
For the evaluation of the toxicity of toxins, we first ligated the inducible promoter pBAD with each toxin in the pJUMP26 backbone (see Parts page). In this way, the toxin gene expression was regulated by the L-arabinose concentration in the environment. After successful transformation of the desired constructs in E. coli TOP10, the strains were inoculated in LB-medium overnight. Then, they were diluted 5 times and pipetted to a 96-well plate in triplicates. Different amounts of L-arabinose were added accordingly to each well. Ampicillin was added to some wells to achieve full cell death as positive controls. Strains containing pBAD-mCherry were used as a negative control to exclude the inhibitory effect of overexpression. The optical density of these cells was measured by plate readers continuously for 10 h to evaluate their viability after toxin expression was induced. The temperature was maintained at 37 °C in the plate reader and the plate shaken at the speed of 120 rpm. Every 12 min the fluorescence and the optical density of each plate were measured.
We also applied minimal medium instead of LB-medium for the toxicity assay. The procedures were similar as described above, except for using M9 minimal medium to prepare the 96-well plate.
Experiment 7: Toxicity assay by LB-agar plate
By plating cells with and without toxin expression, we can obtain different cell viability when toxin expression is induced. To do this, the agar plates with different amounts of L-arabinose as supplements were first prepared. Then, the strains containing different pBAD::toxin constructs were diluted until optical density reached 0.1. Then 5 μL of the bacterial solution were pipetted at the same position of the plates. The plates were put in the incubator overnight at 37 °C. The diameters of the colonies indicated cell viability with or without toxin induction.
Experiment 8: PCR-based cloning
As the promoters we used were less than 100 bp, we noticed difficulty trying to clone the promoters into plasmids. Therefore, primers were developed to ligate the p162 promoter in front of the ccdB, ccdA, RelE and RelB by PCR-based cloning (the list of the primers are shown in Table 2). For the PCR reaction a PCR gradient was performed according to PCR-based cloning protocol. To verify if the promoter was successfully ligated in front of the toxins, gel electrophoresis was performed. We succeeded in creating these constructs via PCR cloning (see Results page). Thereafter, the obtained constructs were used further trying to create the DOPL LOCK system. Although this was not successful due to time constraints, this can still be researched further in the future.
Table 2: The primers used in PCR-based cloning
| RelE_Forward | ATTATGAATTCTAGAGGATCCCTGATGGCTAGCTCAGTCCTAGGGATTATGCTAGCAAAGAGGAGAAATACTAGGTGAGCGAC |
|---|---|
| RelB_Forward | ATATTGAATTCTAGAGGATCCTTGACAGCTAGCTCAGTCCTAGGGATTGTGCTAGCAAAGAGGAGAAATACTAGATGGGTAGCATTAACC |
| ccdB_Forward | ATTATGAATTCTAGAGGATCCCTGATGGCTAGCTCAGTCCTAGGGATTATGCTAGCAAAGAGGAGAAATACTAGATGCAGTTTAAGGTTTACA |
| ccdA_Forward | ATATTGAATTCTAGAGGATCCTTGACAGCTAGCTCAGTCCTAGGGATTGTGCTAGCAAAGAGGAGAAATACTAGATGAAGCAGCG |
| suffix antitox_Reverse | CCTGCAGCGGCCGCTACTAGTA |
| suffix _Toxin_Reverse | CTGCAGCGGCCGCTACTAGTA |
Experiment 9: Competent cells preparation
Two different E.coli strains were used during our lab time, including DH5α and TOP10. DH5α was first used to test the overexpression of toxins, although the DH5α strain metabolized the arabinose. As a result, the promoters were not induced enough to cause bacterial death. The TOP10 bacterial strain was then used for the plate reader assay to induce the toxins. The protocol E.coli competent cells TSS method was used to make competent cells of both E. coli strains. First, the cells were inoculated in liquid LB medium until the culture reached an OD600 between 0.3-0.4.
After centrifugation 5 mL of cold TSS medium was added to the cells and cooled down in liquid nitrogen. Ultimately, the competent cells were stored at -80 °C and thawed before use.
-
3A Assembly
Assembly promoter and insert gene into new plasmid backbone
Calculation
calculate the amount of plasmid and MilliQ needed for each digestion using the NEB calculator for your desired molar ratios. The molar ratio needed depends on the length of the inserts and backbone.
Digestion
Find corresponding restriction enzymes for each plasmid.
Plasmid backbone: EcoRI, PstI
Promoter: EcoRI, SpeI
Insert gene: Xbal, PstI
The ligation solution should contain the following parts (uL):
Plasmid concentration need to be measured in advanced
Plasmid should be added at last
Enzymes and smartbuffer should always be put on ice and stored immediately after it once has been used
Table 7: Digestion mixture
Enzyme 1 0.5 Plasmid ID Plasmid concentration Plasmid water Enzyme 2 0.5 0 x x buffer 1 0 x x MiniQ 8-X 0 x x Plamsid X 100ng in total 49 2.0408163265 5.9591836735 Incubate the digestion solution at 37 degrees for 1h
Heat shock 80 °C for 20min to stop the enzymatic reaction
Ligation
The ligation solution should contain the following parts (uL): see table 8
The amount of gene should have equal molar weight to the plasmid
Using the NEB calculator.
Table 8: Ligation mixture
Plasmid back bone 2 gene 1 X \<3 gene 2 Y \<3 T4 ligase 0.5 T4 ligase buffer 1 MiniQ 6.5-X-Y Leave the solution at room temperature and react for 1.5h
Heatshock at 80 °C for 20 min
Use 5uL (half) of the ligation solution to transform the bacteria.
