Team:Hong Kong JSS/Design
<!DOCTYPE html>
Team:Hong Kong JSS/Design
Hong Kong JSS
Design
Validating the expression of recombinant tvLac / FDR-A
The Trametes versicolor laccase (tvLac)/ FDR-A (MSMEG_5998) expression construct will be cloned into the pSB1C3 vector. The coding sequence of the genes will be expressed by the T7 promoter with lac operon and a T7 terminator. An N-terminal 6-His tag will be added to the sequence for later protein purification steps. The detailed sequence and design can be found in the Parts Design section.
The competent cells used will be BL21 E. coli strain which is compatible with T7 promoter.
After transformation, the cells will be grown to optimum concentration (log phase) and then the expression of the gene will be induced by adding 0.1mM IPTG. After 4 hours, the cells will be harvested and proceed to protein purification.
The protein extract will be prepared by B-PER™ with Enzymes Bacterial Protein Extraction Kit (Thermofisher Scientific) and the His-tagged proteins will be purified by HisPur Ni-NTA Magnetic Beads (ThermoFisher Scientific) following the manufacturer’s manual. The purified protein and protein lysates will be analyzed by SDS-PAGE.
Expected result:
On protein gel, the laccase (97 kDa) / FDR-A (18 kDa) position of induced strain should show a darker band which is a higher protein concentration when compared with untransformed control setups.
The competent cells used will be BL21 E. coli strain which is compatible with T7 promoter.
After transformation, the cells will be grown to optimum concentration (log phase) and then the expression of the gene will be induced by adding 0.1mM IPTG. After 4 hours, the cells will be harvested and proceed to protein purification.
The protein extract will be prepared by B-PER™ with Enzymes Bacterial Protein Extraction Kit (Thermofisher Scientific) and the His-tagged proteins will be purified by HisPur Ni-NTA Magnetic Beads (ThermoFisher Scientific) following the manufacturer’s manual. The purified protein and protein lysates will be analyzed by SDS-PAGE.
Expected result:
On protein gel, the laccase (97 kDa) / FDR-A (18 kDa) position of induced strain should show a darker band which is a higher protein concentration when compared with untransformed control setups.
The functional study of recombinant protein
Meanwhile, the purified laccase / FDR-A from the cell lysate will be used for functional analysis. The purified proteins will be mixed with diluted AFB1 solution. The AFB1 solution should be just above the detectable AFB1 concentration (50 ppb) of the testing kit we used. Therefore, any degradation activity on AFB1 by the recombinant enzyme can be detected in a short time.
Expected result:
The AFB1 testing kit should show a negative result when tested with AFB1 + purified recombinant AFB1. Meanwhile, the control setup (AFB1 alone, and AFB1 + non-induced / non-transformed protein extract mixture) should still show a positive result of AFB1.
Expected result:
The AFB1 testing kit should show a negative result when tested with AFB1 + purified recombinant AFB1. Meanwhile, the control setup (AFB1 alone, and AFB1 + non-induced / non-transformed protein extract mixture) should still show a positive result of AFB1.
Validating the efficiency of recombinant protein secretion
After validating the expression and functions of the recombinant enzymes, a C-terminal secretory signal peptide will be added to the constructs to enable the extracellular secretion of the enzymes by E. coli.
Two signal peptide sequences will be tested to see which has a higher secretory effect. Signal peptide sequences
DsbAss (ATGAAAAAGATTTGGCTGGCGCTGGCTGGTTTAGTTTTAGCGTTTAGCGCATCGGCG) and
NSP4 (ATGAAAAAGATTACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCG)
will either be added to the N terminal of the coding sequence of the constructs. A C-terminal 6-His tag will also be added for later protein purification steps. The detailed design and sequence of the constructs can be found in BBa_K3746009, BBa_K3746007, BBa_K3746011 and BBa_K3746012.
The competent cells used will be BL21 E. coli strain which is compatible with the T7 promoter.
After transformation, the cells will be grown to optimum concentration (log phase) and then the expression of the gene will be induced by adding IPTG to the final concentration of 0.1 mM. After 4 hours, the cells and the culture medium will both be harvested and proceed to protein purification.
The protein extraction and purification procedures will be similar to the above session. The secreted proteins from the culture medium will then be analyzed by SDS-PAGE.
Meanwhile, the purified extracellular laccase / FDR-A in culture medium will also be used for functional analysis. The purified enzymes will be mixed with diluted AFB1 solution. The AFB1 solution should be just above the detectable concentration of the testing kit we used. Therefore, any degradation activity on AFB1 by the recombinant laccase can be detected.
Two signal peptide sequences will be tested to see which has a higher secretory effect. Signal peptide sequences
DsbAss (ATGAAAAAGATTTGGCTGGCGCTGGCTGGTTTAGTTTTAGCGTTTAGCGCATCGGCG) and
NSP4 (ATGAAAAAGATTACCGCTGCTGCTGGTCTGCTGCTCCTCGCTGCCCAGCCGGCGATGGCG)
will either be added to the N terminal of the coding sequence of the constructs. A C-terminal 6-His tag will also be added for later protein purification steps. The detailed design and sequence of the constructs can be found in BBa_K3746009, BBa_K3746007, BBa_K3746011 and BBa_K3746012.
The competent cells used will be BL21 E. coli strain which is compatible with the T7 promoter.
After transformation, the cells will be grown to optimum concentration (log phase) and then the expression of the gene will be induced by adding IPTG to the final concentration of 0.1 mM. After 4 hours, the cells and the culture medium will both be harvested and proceed to protein purification.
The protein extraction and purification procedures will be similar to the above session. The secreted proteins from the culture medium will then be analyzed by SDS-PAGE.
Meanwhile, the purified extracellular laccase / FDR-A in culture medium will also be used for functional analysis. The purified enzymes will be mixed with diluted AFB1 solution. The AFB1 solution should be just above the detectable concentration of the testing kit we used. Therefore, any degradation activity on AFB1 by the recombinant laccase can be detected.
References:
Han, S. J., Machhi, S., Berge, M., Xi, G., Linke, T., & Schoner, R. (2017). Novel signal peptides improve the secretion of recombinant Staphylococcus aureus alpha toxinH35L in Escherichia coli. AMB Express, 7(1). https://doi.org/10.1186/s13568-017-0394-1