Team:GreatBay SZ/Concept

Loading...
Stack Multipurpose HTML Template

Index

Proof of Concept

Overview

Many artworks now have serious fraud problems. These counterfeit products have significantly harmed the rights and interests of consumers and even more disrespect for artists. However, the current appraisal of artworks is poor, complicated and expensive.

In this regard, GreatBay_SZ has developed ARTAG - Artificially Revolutionized Tracking Art Gadget. The Proof of Concept part of ARTAG is mainly divided into three parts:

1. Customized DNA barcode design: User-defined DNA information was integrated into the genome of the yeast.

2. Yeast sporeproduction: Spores were chosen in this project as an ideal carrier for long-time DNA barcode storage and integrated into art-related materials like ink paste.

3. CRISPR-based nucleic acid detection system: CRISPR-based technology was introduced to detect sequences quickly and efficiently in terms of information decoding.

In this page, we present the rich results of the above three sections in ARTAG in detail to demonstrate that ARTAG can meet the requirements of future practical applications like artwork anti-counterfeiting.

Customized DNA barcode design and genome integration

Barcode design

DNA can be used to storage information with a storage density and stability that can theoretically exceed that of a traditional physical hard drive. In this project, the DNA barcode used to storage information is highly customizable by varying the four ATCG bases as well as the length of barcode, which is key to ensuring the the uniqueness of the information and authenticity of the artwork.

We used the following DNA-text message translation chart to transform user-defined messages into DNA sequences.

【fig.1A】Character and DNA sequence translation chart

We designed seven different barcodes, all of which have rich and positive meaning: some are classic quotes from the field of synthetic biology, some are from classic works of art, some are from Chinese culture, and we also included two barcodes about the iGEM team.

Because these barcode needs to be detected by Cas12a (See more in Section 3), we also added the PAM sequence TTTA required for Cas12a recognition to the 5' end of the barcode DNA before integrated them into the yeast genome described in the next section. We constructed all the 7 barcodes from scratch using multiple oligos assembly.Barcode integration into yeast genome

【fig.1B】Word sentences and DNA sequences translation chart
Barcode integration into yeast genome

Since yeast is a common, safe and spore-producing chassis organism, we chose yeast as the carrier of designed DNA barcode.

To integrate these barcodes into the yeast genome for long-term and stable information storage, we first constructed a yeast DNA recombinant plasmid for genome integration

In this recombinant plasmid, there are four main parts.

1. A plasmid backbone that can be used for replication in E. coli, including CoE1 origin and Kanamycin resistance gene.

2. Homologous sequences for genomic recombination at the Ura3 locus of BY4741 yeast: Up Homolog as well as Down Homolog.

3. A uracin expression cassette that can produce uracin for autrophy screening in yeast

4. A gene cassette (with BsaI cut site outside of this region) that can express green fluorescent proteins in E. Coli for improving the screening efficiency of plasmid construction.

Firstly, we construct the plasmid containing our barcode using BsaI golden gate assembly. We then selected E. coli colonies that show no fluorescence on LB agar plate and then sent for sequencing(fig.2C).

Then the correct plasmid with barcode sequenced successfully were digested using NotI for linerization. By transform the linearized DNA into S. Cerevisiae BY4741, the barcode will be integrated into the genome Ura3 locus by bomologous recombination. Yeast colonies were then sent for sequencing and those right ones were used for the next experiment steps.

【fig.2A】process of editing yeast gene
【fig.2B】LB plate before golden gate assembly
【fig.2C】LB plate after golden gate assembly
【fig.2D】Validation of recombinant yeast

Yeast sporation for long-time information storage

Microorganism like yeast and Bacillus subtilis cansurvive under adverse conditions by forming endospores—small spherical structures that are dormant and tough. The DNA is protected by its tight packing by specialized proteins. Spores are able to survive extreme environments, including acid and alkaline solutions, high temperature, freezing, high pressure, X-rays, γ-radiation, and UV light. Spores can lie dormant indefinitely, purportedly for millions of years.

So we chose yeast spores in this project as an ideal carrier for long-time DNA barcode storage and integrated spores into art-related materials like ink paste. They also have strong adhesion so they can stick on the surface of the object for a very long period of time.

Spore production

In some harsh environments such as nitrogen deficiency and non-fermentable carbon source, yeast tends to form spores to protect itself. In order to make yeast spores, we use potassium acetate and glucose to simulate the bad natural environment. The picture below shows the method we used to produce spores(fig.3)[4].

We first wash yeast cell which grew overnight in shaker twice with distilled water, then resuspned yeast colony with spore medium and incubate for 5 days. The spore medium is prepared in advanced which contains potassium acetate and glucose to stimulate spore production. The picture below shows the method we used to produce spores(fig.3)[4]. After the spore were produced in spore medium 5 days late, we dried the medium which contians spore in to powder(fig.3B)

【fig.2】protocol of sporulation
【fig.3】A bottle of spores we made
Verifying the production of spores
Methylene blue staining

To see how spores are produced in yeast cells, we carried out methylene blue staining. The carbon dioxide produced by the living yeasts through aerobic respiration reacts with the methylene blue solution added and turns the methylene blue solution from blue (in oxidized state) to colorless (in reduced state). As a result, the living yeasts which can respire remains colourless and the dead yeasts which can not respire are dyed blue. The spores produced inside the living yeast cells shows a light blue colour and the spore wall is blue. This allows us to distinguish the living and dead cells and see the spores inside the living cells under a microscope to make sure spores are produced by the living yeast cells.

【fig.4A】Before sporulation, yeast and spores stained with methylene blue, we can see the nothing inside the vegetative cell(bule transparent), the vegetative cell is a hollow circle
【fig.4B】After sporulation, yeast and spores stained with methylene blue, we can see the endospores inside the vegetative cell (bule transparent)
Spore staining
pTo verify the production of spores, we used the spore staining method. The wall of the spore is thick, and the permeability is low, so it is difficult to color and decolorize the spores. When dyeing with a strong dyeing agent-Malachite Green Solution- under heating conditions, the dye enters the yeast and spores at the same time. The dye that enters the yeast can be washed out with water, while the dye that enters the spores is difficult to be washed away. After dyeing with another solution-Safranin solution, the spores still retain the color of the original dye, and the yeasts are dyed into the color of the second solution which is red. As a result, the bacteria and spores are dyed red and green respectively so that we can distinguish them. If we can see a greenish color, it means that we have produced spores successfully(fig.6).
【fig.5A】spore staining of yeast before sporulation, the red small dot represent yeast and green dot represent yeast spores, we can not see and greenish color as no spores exist at the moment
【fig.5B】spore staining of yeast after sporulation, for this picture, we did not use safranin to counterstain yeast and spores, so we might not see any red color which represent yeast here.

Integrate barcoded spored into artwork-related materials— seal and inkpaste

Integrate barcoded spored into artwork-related materials— seal and inkpaste

After the above process, we have successfully produced spores that stored specific DNA barcode information. One of the goals of GreatBay_SZ team was to use these spores in the anti-counterfeiting of artworks, so we chose seal from Chinese culture for a demonstration.

A seal is a piece of tool used to signify an identification or signature on a document, and is usually painted and then printed. In China, the seal is a fusion of carving and calligraphy, and is an art style inseparable from Chinese calligraphy and painting. In Western traditions, seals were also used to seal official court documents or letters for communication. In some countries, such as China or Japan, the seal has the force of law. By combining the biotechnology-driven, spore-based ARTAG system with the seal, we can achieve more efficient security for the seal and its corresponding artwork.

Following the steps below, we mixed the dried spores into the Inkpaste needed for the seal.

1. Prepare 0.06g dried spore, 1g inkpad, 300ul DMSO

2. Crush the dried spore into powder using mortar and pestle.

3. Dissolve 0.06g dried spore into 300ul DMSO. (it takes very long time to dissovle, it better to put it into shaker or using vortex oscillator)

4. Add dissolved spores into inkpad and mix them thoroughly.

Then we painted the seal with inkpaste and stamped it on the paper materials used for Chinese calligraphy and painting.

So far, this painting or calligraphy work now carries a special seal pattern that contains spores storing specific information. In addition to graphic and textual information, this pattern also contains user-defined genetic information that is difficult to decipher, greatly increasing the difficulty of counterfeiting and achieving a high degree of anti-counterfeiting of the artwork.

【fig.6】making spore inkpad

CRISPR-based nucleic acid detection system to decode information of barcodes

After the above steps, we successfully applied the ARTAG system to the artwork.

When it is necessary to identify the authenticity of a work of art, we need a system that can decode the barcode. Therefore, we applied a highly sensitive CRISPR Cas12a-based nucleic acid detection system that can effectively decode the barcode to determine the authenticity of the artwork.

This section is divided into three steps: the processing of spore samples, the amplification of barcode, and the CRISPR-Cas12a-based nucleic acid detection.

In the future, we can analyze the barcode by a third-party institution or use the hardware tool designed by GBSZ to perform on-site anti-counterfeit authentication (for more information, please check the hardware page).

Sample collection and processing

We collected the spores from the stamp on the painting for detection. The method is shown below.

1. Sterile nylon swabs (Becton Dickinson) were dipped into sterile swab solution (0.15 M NaCl + 0.1% Tween-20) and excess liquid was wiped away.

2. The damp swab was rubbed over the object, covering each part of the surface, twice.

3. The tip of the swab was clipped into a microcentrifuge tube, and 200 μL of freshly prepared 200 mM NaOH was pipetted onto the swab.

4. The tube was heated to 95°C for 10 min, then the base was neutralized with 20 μL 2 M HCl, and buffered with 20 μL 10x TE buffer (Tris-HCl 100 mM, EDTA 10 mM, pH 8.0).

5. Lysate samples were optionally purified with 1x AMPure XP bead protocol (Beckman Coulter).

【fig.7】Spore Collection and Lysis
Barcode amplification using RPA method

It is reported that the minimum detectable concentration for Cas12a-crRNA was approximately 0.1 nM; However, When combined with PCR, the detectable concentration could be as low as 10 aM.

So we need to amplify the barcode in the genome of the spores first before nucleic acis test. RPA, recombinase polymerase amplification, which is quite similar to PCR, but can be carried out at 37℃. Special primers are needed for RPA and some rules must be followed when designing the primers.

1. The initial 3 to 5 nucleotides should avoid the cluster of G, and it is preferable if they are C.

2. It is preferable if the 3 nucleotides at the 3’ end is G or C. This improves the stability of recombinase.

3. The GC-content should be between 30-70% to prevent secondary structure like harpin loop from forming.

4. Repeats should be avoided in the targeting sequence to prevent harpin loop from forming.

5. The cluster of purine or of pyrimidine should be prevented.

In our experiment, we successfully amplified the barcodes with RPA, the amplified barcodes are then used for CRISPR-Cas12a detection.

【fig.8】barcode after RPA amplification
CRISPR-Cas12a-based nucleic acid detection

In order to detect the barcode, we used CRISPR-Cas12a detection system. We designed crRNAs for each barcode so that the cas12a-crRNA complex can recognize the specific barcode sequences(fig.12).

crRNA design

To design crRNA, 20 base pairs of barcode RNA transcript next to the PAM(TTTA) were added to the 3' end of the repeat sequences: 5´- UAAUUUCUACUAAGUGUAGAU -3´[3]. We have designed 7 crRNA for each barcode and used them for the next Detection steps.

Notice:

1. A single nucleotide variation in the leader sequence will not affect the cleavage.

2. The loop mutation that retains the RNA duplex will not affect the cleavage, and the mutation that destroys the structure of the loop duplex will directly stop the cleavage.

3. The base replacement in the loop region does not affect the nuclease activity, and the uracil base immediately before the leader sequence cannot be replaced.

4. The seed region is in the first 5 nt of the guide sequence, and the mismatch between the seed region and the target strand DNA has an adverse effect on DNA cleavage.

【fig.9】corresponding crRNA sequence for each barcodes
Detection

The crRNA is designed to be complementary to the target DNA sequence. So when the cas12a-crRNA complex is added to the system, the crRNA will recognize the target DNA sequence and bind with it, forming a ternary complex. Then the cas12a protein will start to cut the single strand DNAs (ssDNA)-it will cut not only on the target sequence, but also any single strand DNA that presents in the system. As a result, the ssDNA probe added into the reaction system will be cut by the cas12a protein. Depending the type of ssDNA probe added into the system, the probe will either produce florescence or show a red line on the test stripe(fig.14)[4].

【fig.10】cas12a detection

We carried out detection for all the barcodes and got the following results. We used both the test strip and the florencence method. For the test strip, we successfully got the correct result for all the barcodes. For the florencence method, we got the graphs of the florencence against time(fig.13), which were proofed right by our model(link到model页面).

【fig.11】cas12a test strip result
【fig.12】cas12a fluorescence detection result. On the left of the symbol "-" refers to barcode name; On the right of the symbol "-" refers to crRNA name. All results for barcode mismatch with crRNA are shown in grey. E.g. "T-T" means the mixture of T-barcode and T-crRNA.

Barcode information consists of DNA bases, which are highly customizable in length and composition by the user, so the key to the whole Artag system is the uniqueness and orthogonality between each barcode to ensure that different barcodes do not interfere with each other during detection. We measured the performance between different crRNAs and barcodes, and we found a high orthogonality between barcode and crRNA, which further ensures the accuracy of the detection results.

【fig.13】Heatmap of endpoint fluorescence values from in cas12a fluorescence detection of all combinations of 7 barcodes and 7 crRNAs assessing specificity of each barcode-crRNA pair.

Reference

  1. Neiman A. M. (2005). Ascospore formation in the yeast Saccharomyces cerevisiae. Microbiology and molecular biology reviews : MMBR, 69(4), 565–584. https://doi.org/10.1128/MMBR.69.4.565-584.2005
  2. 曾洪梅, & 徐浩. (1993). 面包酵母子囊孢子的形成条件及细胞学研究. 微生物学报, 033(002), 92-97.
  3. Zetsche, B., Gootenberg, J. S., Abudayyeh, O. O., Slaymaker, I. M., Makarova, K. S., Essletzbichler, P., Volz, S. E., Joung, J., van der Oost, J., Regev, A., Koonin, E. V., & Zhang, F. (2015). Cpf1 is a single RNA-guided endonuclease of a class 2 CRISPR-Cas system. Cell, 163(3), 759–771. https://doi.org/10.1016/j.cell.2015.09.038
  4. Patchsung, M., Jantarug, K., Pattama, A., Aphicho, K., Suraritdechachai, S., Meesawat, P., Sappakhaw, K., Leelahakorn, N., Ruenkam, T., Wongsatit, T., Athipanyasilp, N., Eiamthong, B., Lakkanasirorat, B., Phoodokmai, T., Niljianskul, N., Pakotiprapha, D., Chanarat, S., Homchan, A., Tinikul, R., Kamutira, P., … Uttamapinant, C. (2020). Clinical validation of a Cas13-based assay for the detection of SARS-CoV-2 RNA. Nature biomedical engineering, 4(12), 1140–1149. https://doi.org/10.1038/s41551-020-00603-x
  5. Qian, J., Lu, Z. X., Mancuso, C. P., Jhuang, H. Y., Del Carmen Barajas-Ornelas, R., Boswell, S. A., Ramírez-Guadiana, F. H., Jones, V., Sonti, A., Sedlack, K., Artzi, L., Jung, G., Arammash, M., Pettit, M. E., Melfi, M., Lyon, L., Owen, S. V., Baym, M., Khalil, A. S., Silver, P. A., … Springer, M. (2020). Barcoded microbial system for high-resolution object provenance. Science (New York, N.Y.), 368(6495), 1135–1140. https://doi.org/10.1126/science.aba5584