<!DOCTYPE html> Site Igem

Primers

All primers created by our team, primers from parts or primers from our laboratory collection are shown.

When primers are created from our team (iGEM 2021 Aix-Marseille), the nomenclature is the following (o21x) :

o : oligonucleotide
21 : year of the iGEM team
x : primer’s number

Example, o2124 : oligonucleotide number 24 from the iGEM 2021 team.

They were classified by category of use and could be used both for verification PCRs, PCRs allowing cloning or sequencing.

Concanavalin A : Exportation system to the extracellular membrane

Name	Description	Sequence (floating end)
o211	Fw pelBsfGFP : amplification of pelbsfGFP in BBa_J04500	5' - ATCGAATTCGCGGCCGCTTC - 3'
o212	Rev pelBsfGFP : amplification of pelbsfGFP in BBa_J04500	3’ -TATCTGCAGCGGCCGCTAC-3’
o2125	Fw SLIC pelB sfGFP1 : amplification of pelB sfGFP1 with floating end to hybridate in pBAD24	5'-TTTTTGGGCTAGCAGGAGGAATTCACCATGGggaaatacctgctgccgaccgct-3'
o2127	Rev SLIC pelBsfGFP2 : amplification of pelBsfGFP2 with floating end to hybridate in pBAD24_pelBsfGFP_aidaI with a floating end corresponds to aida-I 5’ sequence	5'-CACGGTCAAGGTGTTTCCTGCCATtttgtacagttcatccataccatgcg-3'
o2128	Fw SLIC aida-I: amplification of aida-I	5'-ATGGCAGGAAACACCTTGACCGT-3'
o2129	Rev SLIC aida-I: amplification of aida-I with floating end to hybridate in pBAD24	5'-TCGACTCTAGAGGATCCCCGGGTACCATGGttaaaaactgtatttgatccctaatgcc-3'
o2146	Fw SLIC aida-I from BBa_K257018: amplification of aida-I with floating end to hybridate in pBAD24_pelBsfGFP_aidaI with a floating end that hybridates on the end of pelBsfGFP	5'-gcatggtatggatgaactgtacaaaGCAGGTAATACTCTTACCGTGTCA-3'
o2147	RevSLIC aida-I from BBa_K257018: amplification of aida-I with floating end to hybridate in pBAD24	5'-CTAGAGGATCCCCGGGTACCATGGTTATTAGAAGCTGTATTTTATCCCCAG-3'

Concanavalin A : way to viruses detection

Name	Description	Sequence (floating end)
o213	conA rev 1 : first conA amplification (Adding BamHI restriction site)	5' - taGGATCCcgccagagcc - 3'
o214	conA rev2 : seconde conA amplification (adding suffix sequence)	5' - ctgcagcggccgctactagtaGGATCCcgccagagcc - 3'
o215	Fw conA : conA amplification (sequence from BBa_K3788005)	5’- gttccggtactggctctggcgggatcGCCATTTCCAAGAAAAGCTCGC -3’
o216	Rev conA : conA amplification (sequence from BBa_K3788005)	5’- ctgcagcggccgctactagtaGGATCTTATACGACAGTGGCAATATCGGGAATC -3
o2130	Fw SLIC conA-linker-conA : amplification of conA with floating end to hybridate in pBAD24	5'-ATGCACCATCACCATCACCATGCC-3'
o2131	Rev SLIC conA-linker-conA : amplification of conA with floating end to hybridate in pBAD24	5'-CACGGTCAAGGTGTTTCCTGCCATtacgacagtggcaatatcgggaatc-3'
o2140	Fw SLIC conA : amplification of conA with floating end to hybridate in pBAD24 (right ORF)	5'-GGGCTAGCAGGAGGAATTCACCATGGggCACCATCACCATCACCATGCCATTTC-3'
o2136	Rev SLIC conA : amplification of conA with floating end to hybridate in pBAD24 (STOP added)	5'-CTAGAGGATCCCCGGGTACCATGGTTATACGACAGTGGCAATATCGGGAATCTC-3'

Timer lysis device

Name	Description	Sequence (floating end)
o217	Fw gfp col2 : addition of the SacI site in 5 'on the gfp for	5' - atagagctcaatgcgtaaaggagaagaacttttc - 3'
o218	Rev gfp col : addition of the 3 'BssHII site on the gfp for cloning in pRL1	5’ cttctcctttacgcatgctgagctat 3’
o2123	hybridization on gfp	5' - cgtgctgaagtcaagtttgaag - 3'
o219	Fw rfp col : part of rfp with floating end to hybridate in cal (coding for lysis protein)	5' - caatgtcagggatactggaggtggttctgttatggcttcctccgaagacgttatc-3’
o2110	Rev rfp col : part of rfp with floating end to hybridate in cal (coding for lysis protein)	5’-GAcgatcgtaaaaggatctcaagaagatcctttaagcaccggtggagtgacgAC
DD114	hybridization on rfp (coding for ColA)	5’-GCAGAATAGATAAACAATTGCCCAATAGACCAATGGACTTAATAAACA-3’
DD14	hybridization on caa (coding for ColA)	unknow
o2144	Fw megapriming pRL1 : remove XbaI restriction site	5'-gccaaagatgagcgggagcttTtagaaaaaaccagtg-3'
o2145	Rev megapriming pRL1 : remove XbaI restriction site	5'-cactggttttttctaAaagctcccgctcatctttggc-3'

Bacillus thuringiensis toxins and mosquitoes death

Name	Description	Sequence (floating end)
o2111	Fw cry11a : amplification of cry11Aa with floating end to hybridate in pBAD24	5’-GGGCTAGCAGGAGGAATTCACCATGGATTATAAAGACGACGATGATAAAGAAGATAGTTC-3'
o2112	Rev cry11a : amplification of cry11Aa with floating end to hybridate in pBAD24	5’-GAGGATCCCCGGGTACCATGTTATTTCAGCAACGGGTTAATCTGTGTCG-3'
o2113	Fw cyt1Aa amplification of cyt1Aa with floating end to hybridate in pBAD24	5’-GGGCTAGCAGGAGGAATTCACCATGGGCTGGAGTCATCCTCAATTTGAAAAAGAAAATC-3'
o2114	Rev cyt1Aa amplification of cyt1Aa with floating end to hybridate in pBAD24	5’- GAGGATCCCCGGGTACCATGtatggcttcctccgaagacgttatc-3’
o2115	Fw p20 amplification of p20 with floating end to hybridate in pBAD24	5’- GGGCTAGCAGGAGGAATTCACCTTACAATGTGCCGTTAATGGCAGAG-3'
o2116	Rev p20 amplification of p20 with floating end to hybridate in pBAD24	5’ – GAGGATCCCCGGGTACCATGTTAGGTCAGGTAGGTCATGGTGAC -3'
ebn 158	Fw pBAB24 : hybridization on the empty vector	5’-ATCGCAACTCTCTACTGTTTCTCCATACCCG-3'
ebn 159	Rev pBAD24 : hybridization on the empty vector	5’-cgcgctactgccgccaggc-3’
o2119	Rev p20 : hybridization on p20 rev	5'- AATTTTATTGCTATCCTGCTCCAGCG-3'
o2120	Rev cyt1Aa : hybridization on cyt1Aa rev	5'-GTTGGTCAATAACGCTCCCTGA-3'
o2121	Rev cry11A : hybridization on cry11Aa rev	5'-AGGCAAACGCTGAATAATAGCACC-3'
o2122	Fw cry11A : hybridization on cry11Aa fw	5'-TTAGCATCTCGAGTGATTCGCTT-3'
o2139	Fw toxto : amplification of cyt1Aa with floating end to hybridate in pBAD24_6hisp20_flagcry11Aa and a RBS	5’-CACAGATTAACCCGTTGCTGAAATAACATGGTACCAGGAGGAATAAATAATGTGGAGTCATCCTCAATTTGA-3’
o2135	Rev toxto : amplification of cyt1Aa with floating end to hybridate in pBAD24_6hisp20_flagcry11Aa	5’-GCCTGCAGGTCGACTCTAGAGGATCCCCGGTTACAATGTGCCGTTAATGGCAG-3’

Primer specific of a vector