Team:Aix-Marseille/design
<!DOCTYPE html>
Design
Overview
Figure 1: General design for our ARBO-BLOCK project.
Asaia bogorensis and E. coli to engineered ARBO-BLOCK
Chassis Asaia bogorensis
The final objective of our project is the sustainable integration in time of our construction into the Aedes albopictus (tiger mosquito). Asaia bogorensis is the perfect candidate. This bacteria is largely studied and documented. Infact, it is a gram negative bacteria found in the Aedes albopictus microbiota and able to colonise midgut, ovaries and salivary glands. One of the main advantages is the ability to be transferred horizontally and vertically from mosquito to mosquito. This allows a perennial transmission of our construction (1,4,5).
Furthermore, mosquitoes are important for the environment and ecosystem. It has an important role in pollinization because in adulthood it feeds on the nectar of flowers. It thus highlighted the Asaia bogorensis presence in different plants such as orchid tree (Bauhinia purpurea) and of plumbago (Plumbago auriculata) (2, 3).
It is easy to imagine that the implantation of genetically modified Asaia bogorensis into these plants allows an efficient horizontal transmission of our vector into Aedes albopictus.
Chassis Escherichia coli strain
Using A. bogorensis in the laboratory is tricky because it is a bacterium manipulated in type II laboratory, and we do not have the equipment to manipulate it in safe condition. Escherichia coli is a gram negative bacterium used as chassis in many laboratories instead of A. bogorensis.Employing E. coli strain as a proof of concept is an alternative method that permits less restrictive preliminary studies, before the implantation of the system in A. bogorensis.
Concanavalin A: a way to detect viruses
To know if the mosquito is infected with an arbovirus, our bacterium must be able to produce a protein, to detect and recognize it. For this purpose, we had to choose which part of the virus could be detected. Our choice was to focus on the envelope protein of these viruses, the viral glycoprotein E. Our sensor must therefore be able to fix glycoproteins: we must design an optimized sensor showing high affinity and specificity to the targeted viral molecule.
Track selection
The biosensor
We chose lectin as a bio-sensor because it binds viral E proteins, specifically glycosylations. This lectin is Concanavalin A (ConA), belonging to the carbohydrate-binding protein family (6). ConA can be found under tetrameric or dimeric conformation, depending on the environmental pH. However, it has been shown that its highest specificity to E proteins is achieved with its dimeric structure. To ensure this, our ConA sequence must contain a substitution to cancel the effect of pH on polymerization. Substitutions made are:
- Histidine 51 to Serine,
- Histidine 114 to Phenylalanine,
- Glutamate 192 to Proline.
In order to force ConA dimerization, the two proteic subunits of ConA must be linked by a linker as a single gene. Finally, as we wanted to produce the protein -to determine its viral recognition ability- a His-tag was added to help ConA purification and detection (7).
The linker
The linker will allow us to fuse the two different monomers of ConA, to promote the formation of the dimer. After analysis with ICM-Browser pro software, we were able to determine the distance between the C-terminal and N-terminal of ConA monomers, and this helped us to choose the right linker. The latter connects the C-terminal to the N-terminal of each monomer. We chose a linker already registered in iGEM biobricks (BBa_K404301, named GSAT-Linker, Figure 2) coding for a 36 amino acids sequence rich in Glycine and Serine, which allows structure flexibility, which enhances dimerization of the two ConA monomers.
Figure 2: Global representation of the biosensor gene.
Global cloning strategy
conA-linker construction
ConA sequence were ordered from IDT, its sequence (following) contains the linker, as well as all the sequences for digestion/ligation cloning according to the RCF10 standard in the J04500 plasmid.
ATCGAATTCGCGGCCGCTTCTAGAGATGCACCATCACCATCACCATGCCATTTCCAAGAAAAGCTCGCTGTTTCTGCCAATCTTCACGTTCATTACCATGTTCCTGATGGTCGTCAACAAGGTTAGCTCGAGTACACATGAAACCAACGCATTGCACTTCATGTTCCATCAGTTTTCCAAAGATCAGAAAGATCTGATTCTTCAAGGCGATGCTACTACTGGCACCGATGGAAATCTGGAGCTTACGCGCGTGAGCTCAAACGGCTCTCCGCAAGGCAGTAGTGTCGGTCGTGCGCTGTTTTACGCACCTGTGCACATTTGGGAAAGCAGTGCAGTTGTAGCGTCATTTGAAGCGACGTTTACGTTCCTGATCAAATCGCCTGATTCTCATCCAGCAGATGGGATTGCGTTCTTTATCTCCAACATTGACAGCTCTATTCCGAGCGGTAGTACCGGTCGCCTCTTGGGTCTGTTTCCGGATGCCAATGTGATCCGGAATAGCACCACAATTGACTTTAACGCGGCATATAACGCGGATACCATCGTTGCGGTAGAACTCGATACCTATCCGAACACGGACATTGGTGATCCGAGCTATCCGCATATTGGCATCGATATCAAATCGGTGCGTTCTAAGAAAACCGCCAAATGGAACATGCAGAATGGGAAAGTGGGAACAGCCCACATCATCTACAATTCTGTGGACAAACGCTTGTCCGCTGTTGTGTCATATCCCAATGCTGACAGTGCCACTGTTTCGTACGATGTCGACTTAGACAACGTGTTACCGGAATGGGTGCGTGTTGGCTTATCCGCGTCAACCGGCCTGTATAAGGAAACGAACACCATTCTGTCATGGAGCTTTACCTCGAAACTGAAAAGCAATGAGATTCCCGATATTGCCACTGTCGTAggtggttctgccggtggctctggttctggctcttctggtggctcttctggtgcgtccggcacgggtactgcgggtggcactggcagcggttccggtactggctctggcGGATCCtactagtagcggccgctgcagATCAT
Using the previous construction, conA coding sequence deleted from its ATG will be re-amplified by PCR. The finale conA-linker-conA construction was produced using the SLIC method during cloning in the BBa_J04500 plasmid.
ATGCACCATCACCATCACCATGCCATTTCCAAGAAAAGCTCGCTGTTTCTGCCAATCTTCACGTTCATTACCATGTTCCTGATGGTCGTCAACAAGGTTAGCTCGAGTACACATGAAACCAACGCATTGCACTTCATGTTCCATCAGTTTTCCAAAGATCAGAAAGATCTGATTCTTCAAGGCGATGCTACTACTGGCACCGATGGAAATCTGGAGCTTACGCGCGTGAGCTCAAACGGCTCTCCGCAAGGCAGTAGTGTCGGTCGTGCGCTGTTTTACGCACCTGTGCACATTTGGGAAAGCAGTGCAGTTGTAGCGTCATTTGAAGCGACGTTTACGTTCCTGATCAAATCGCCTGATTCTCATCCAGCAGATGGGATTGCGTTCTTTATCTCCAACATTGACAGCTCTATTCCGAGCGGTAGTACCGGTCGCCTCTTGGGTCTGTTTCCGGATGCCAATGTGATCCGGAATAGCACCACAATTGACTTTAACGCGGCATATAACGCGGATACCATCGTTGCGGTAGAACTCGATACCTATCCGAACACGGACATTGGTGATCCGAGCTATCCGCATATTGGCATCGATATCAAATCGGTGCGTTCTAAGAAAACCGCCAAATGGAACATGCAGAATGGGAAAGTGGGAACAGCCCACATCATCTACAATTCTGTGGACAAACGCTTGTCCGCTGTTGTGTCATATCCCAATGCTGACAGTGCCACTGTTTCGTACGATGTCGACTTAGACAACGTGTTACCGGAATGGGTGCGTGTTGGCTTATCCGCGTCAACCGGCCTGTATAAGGAAACGAACACCATTCTGTCATGGAGCTTTACCTCGAAACTGAAAAGCAATGAGATTCCCGATATTGCCACTGTCGTAggtggttctgccggtggctctggttctggctcttctggtggctcttctggtgcgtccggcacgggtactgcgggtggcactggcagcggttccggtactggctctggcGgatcGCCATTTCCAAGAAAAGCTCGCTGTTTCTGCCAATCTTCACGTTCATTACCATGTTCCTGATGGTCGTCAACAAGGTTAGCTCGAGTACACATGAAACCAACGCATTGCACTTCATGTTCCATCAGTTTTCCAAAGATCAGAAAGATCTGATTCTTCAAGGCGATGCTACTACTGGCACCGATGGAAATCTGGAGCTTACGCGCGTGAGCTCAAACGGCTCTCCGCAAGGCAGTAGTGTCGGTCGTGCGCTGTTTTACGCACCTGTGCACATTTGGGAAAGCAGTGCAGTTGTAGCGTCATTTGAAGCGACGTTTACGTTCCTGATCAAATCGCCTGATTCTCATCCAGCAGATGGGATTGCGTTCTTTATCTCCAACATTGACAGCTCTATTCCGAGCGGTAGTACCGGTCGCCTCTTGGGTCTGTTTCCGGATGCCAATGTGATCCGGAATAGCACCACAATTGACTTTAACGCGGCATATAACGCGGATACCATCGTTGCGGTAGAACTCGATACCTATCCGAACACGGACATTGGTGATCCGAGCTATCCGCATATTGGCATCGATATCAAATCGGTGCGTTCTAAGAAAACCGCCAAATGGAACATGCAGAATGGGAAAGTGGGAACAGCCCACATCATCTACAATTCTGTGGACAAACGCTTGTCCGCTGTTGTGTCATATCCCAATGCTGACAGTGCCACTGTTTCGTACGATGTCGACTTAGACAACGTGTTACCGGAATGGGTGCGTGTTGGCTTATCCGCGTCAACCGGCCTGTATAAGGAAACGAACACCATTCTGTCATGGAGCTTTACCTCGAAACTGAAAAGCAATGAGATTCCCGATATTGCCACTGTCGTATAAGGATCC
In order to control the previous sequence, it will be under an IPTG-inducible promoter present in the J04500 plasmid.
Figure 3: Plasmid Map of BBa_J04500 encoding for conA-linker-conA.
Secretion of the sensor protein, ConA
We want to produce a protein allowing the virus to be detected at the outer membrane of our bacterium. As we work on E. coli , which is a gram negative bacterium, we first need to test if ConA can be transported in the periplasm. To achieve this, we cloned a signal sequence and a reporter protein in a vector to allow production of the reporter protein in the periplasm of our bacteria. Once the construction was completed, we were able to quantify and determine the location of our protein.
Track selection
Exporter system to the periplasm
Since our ultimate goal is to produce a protein made up of a dimer whose subunits are linked by a linker sequence, to ensure that the protein goes through the periplasm, we want it to be folded after it passes the internal membrane. For this purpose, our protein has to be transported by the Sec system.
The PelB leader sequence, present in E. coli, allows proteins to go through the Sec secretion system. In addition, the sequence is already listed on the iGEM website and is present in the plates provided by iGEM (Part BBa J32015). This sequence is therefore interesting to use in our project.
Figure 4: Common sequence of a signal peptide of the Sec system and cleavage site (retrieved from (8)).
Figure 5: Signal Sequence Type Prediction by SignalP-5.0 (Analysis from Translated Sequence).
Control strategy for ConA secretion in the periplasm
We needed a reporter protein to verify that the construction was properly expressed. An obvious choice was to have a GFP production,
in order to easily quantify the fluorescence level.
Since the aim of our construction is to test the ability of the signal peptide to allow the passage of proteins to the periplasm, we chose a variant of GFP: sfGFP. It has been designed to go through the Sec system. “Thus, unlike other commonly used GFP derivatives, sfGFP is folded and fluorescent following Sec export.” (9).
In addition, sfGFP is present in the plates provided by iGEM (Part: BBa l746916) and compatible with RFC10; so we could integrate it into an iGEM plasmid easily.
Global cloning strategy
Plasmid choice for periplasm secretion
To test the production and localization of our protein of interest, we do not need to overproduce it;
on the other hand, it is interesting to put the genes of interest under the control of an inducible promoter to avoid saturating
the bacterium’s Sec system.
By integrating these constraints, we decided to use a detailed vector on the iGEM website and found in the plate
provided by iGEM, and which integrates an IPTG inducible promoter and an RBS (Part: BBa J04500).
Exporter system to the external membrane
We now need to transport the produced protein to the outer membrane. To achieve this, we made a construction in which we added the sequence of a linker and a beta-barrel from the Aida-I autotransporter
to the BBa_K3788025 sequence (Part: BBa K3788025).
The first step to produce a protein at the outer membrane is to address it to the periplasm; to test the ability to be exported at the outer membrane, we used the same construction as we did to test the transport to periplasm: BBa_K3788025.
To ensure that our construction would not encounter any problem due to the fact that it is coming from another species, we looked for autotransporters coming from E.coli . Aida-I is an TSS5 autotransporter that plays a role in bacterial attachment to a lot of eukaryotic cells, it also plays a role in biofilm formation initiation.
The aida-I sequence, as an auto display system, encodes for a protein constituted of 4 parts:
- a signal peptide, allowing transport to the periplasm,
- a passenger protein: protein transported outside of the bacteria to play its role,
- a linker: small sequence that will pass into the beta-barrel to allow the passenger protein to be well presented at the outside of the cell,
- a beta-barrel: sequence constituted from beta-sheets and intra/extracellular parts forming a pore into the membrane to allow the passenger protein passage.
Figure 6: Aida-I autotransporter mechanism (retrieved from (10)).
As we already determined what will be our signal peptide and passenger protein, we will not integrate these parts of the aida-I sequence in our construction, and we will replace it with BBa_ K3788025. We obtained the sequence from NCBI (11) and optimized the codon usage to ensure that there is no restriction site used in the RFC10 cloning standard.
Aida-I allows protein secretion and release in the extracellular medium. However, to have a virus detection system, we don’t want our construction to be cleaved from the bacterial membrane. The literature indicates that a D33N mutation in our sequence would clear the cleavage site so that our construction will be anchored in the bacterial membrane (12).
The last change we added to the aida-I autotransporter sequence is the addition of the prefix and suffix to clone the sequence with the RFC10 standard.
From viral detection to internal signal
We decided to focus only on the designing part of this tep of our project in order to save type in the lab.
The main idea was to design a biosynthetic peptide and
merge this peptide directly on the ConA sequence.
We already mentioned that ConA interacts with viral glycoproteins. To permit a signalling mechanism triggered by the detection of a virus, we wanted to control this interaction. To control this interaction, we needed to know which domains of ConA interact with viral glycoproteins. The knowledge of these domains pushed
us to think that we needed to work on ConA conformation, to control it. A lot of knowledge in biochemistry are required to control the conformational change of ConA which is quite
difficult. So we came up with the idea of designing a specific biosynthetic peptide that can bind directly on the ConA glycoprotein affinity domain.
The peptide would be composed of three main domains. The first one will bind the peptide to the ConA protein, the second one will be able to activate a specific system to transduce the information through the membrane and the last one will have an interaction with the glycoprotein interaction domain of ConA.
Figure 7: Peptide signal design.
The yellow domain at the N-terminal side, will have the capacity to interact with the glycoprotein binding domain of ConA. For this purpose, it has to be composed of Proline-Tyrosine-Proline amino acid. We read that many peptides composed of these three amino acids have been tested in the past for their interaction with the binding domain of ConA. Our idea is to have a specific interaction but with a low affinity. In this case, when a virus fixes ConA, it will have a better affinity for the glycoprotein binding domain, induce peptide release, as we can see in the following figure.
Figure 8: Peptide signal releasing after viral detection via ConA.
The green domain is involved in the signalization to the internal space. We decided to use the two-components system, TonB, to initiate the signalization through the external and internal membrane. The green domain (from the peptide signal) will have the capacity to bind to the external part of TonB. The latter will be able to transmit the information in the bacteria as we can see in the following figure.
Figure 9: Signalisation pathway through TonB system.
The red domain corresponds to a linker used to hook the signaling peptide to ConA and prevent it from being lost in the extracellular medium after viral interaction.
The idea of the "timer lysis device"
A way to kill mosquitoes and bacteria
We first thought about producing the Cry and Cyt toxins into Asaia and addressing them to a secretion system. But this idea was not viable. Indeed, to be able to kill mosquitoes with our system we need to have a huge production of our toxins fastly.
But, with a secretion system, the overproduction of the secreted proteins can lead to a saturation of the pores; the toxins may not be released quickly enough. Moreover, the model bacteria that we use in our research (E. coli) naturally exhibit a strong inability to easily secrete recombinant proteins into the extracellular environment.
Even if optimization solutions exist with improved signal peptides for example, this solution was not profitable and efficient in our case (13).
So we looked at another method to release our toxins: cell lysis.
Indeed, this method will allow the release in high concentration of our proteins in the extracellular environment in a single blow, during lysis. Furthermore, this technique will lock our system, when a bacteria detects a virus, the bacteria will die and there is no spread of the whole construction.
But a limit to this system appeared to us: the lysis must be a programmed lysis, the bacteria must be lysed when enough toxins have been produced otherwise the mosquito could not be eliminated.
The emergence of the "timer system"
Thus we decided to create a “timer system”, first we produce the toxins which accumulate then the lysis releases the toxins which will kill the mosquito.
Figure 10: First design of our Timer. We wanted to use the holin and endolysin system to induce bacterial death.
We had to imagine a system with 5 times more production of toxins than the lysis system to produce it at sufficient amounts. To do this, we will use a strong promoter for the toxins and a weak one for the holin and endolysin genes. In addition, we want the weak promoter to be inducible so as not to have constitutive production of lysis proteins, which could therefore kill bacteria even when no viruses are detected.
Choice for the weak promoter and the protein of interest
We first thought about the T7 polymerase system, yet the transcription was too strong and not a viable system. Later, we discussed three options (14):
- Find a weak promoter and its activator that are not present in Asaia sp. and E.coli strain. However it is a huge work and weak promoters are less studied.
- Using an alternative sigma factor and its promotrice sequence to create an artificial promoter. But we must find a sigma factor not present into Asaia sp. and E. coli strain.
- Using a weak viral promoter like the polyhedrin promoter from baculovirus. The advantage is that viral compounds are not naturally present in bacteria and it is easier to use it without background effects. But as they are sequences from viruses, they are not allowed in the IGEM competition.
In the search for such a system, we found the plasmid pRL1, which is a finely regulated biological timer with an promotor LexA dependant, which enables the SOS response, in E. coli that allows the production of a toxin, colicin A, an immunity protein and a protein that allows the lysis of the bacterium.
This plasmid was presented to us by our instructors because we studied in our host laboratory. It contains an ampicillin resistance cassette.
Figure 11: Operonic structure and regulation of the colicin A system with an alternative LexA box. caa: colicin A gene; cai: CaI immunity protein gene; cal: CaL lysis protein gene.
Thus, based on the colicin system, the objective would be to engineer the basic system in order to adapt it to our case study while preserving the key elements of regulation.
As a result, the colicin gene, useless in our case, will be truncated with the toxins targeting the mosquito. Finally, the lysis protein Cal is not the one we are going to use, so it will also be truncated to the lysis proteins that we want to use.
Figure 12: Final design of our timer. The colicin cai immunity gene is also useless but its sequence seems to play an essential role in the regulation of the system, so we cannot allow ourselves to eliminate it.
Construction to test our timer
In order to characterize this system to understand its function and to best adapt it to our needs, we have designed several constructions.
PLR1 GFP-ColA
This first construction which with the composite parts BBa_K3788023 and BBa_K3788019 consists in carrying out a fusion between colicin A (caa) and GFP by restriction ligation cloning in order to get an idea of the time required for the activation and production of the protein. The main difficulty is to limit the impact of the fusion on the regulatory sequences of the immunity protein.
Figure 13: Representation of the part BBa_K3 788 019. caa fused to gfp by reserving its 5’ region with its RBS and its 3’ region with the cai terminator. cai: gene of the immunity protein CaI; cal: gene of the lysis protein CaL. The pink segment is the 3’ region of caa containing the terminator of cai.
pRL1-RFP-lysis
This second construct is a fusion between the lysis protein coding sequenc(al) and the RFP coding sequence in order to follow the production of Cal
protein. Once again, the difficulty is to not affect the regulatory sequences of the system. pRL1 being a weak plasmid, there is no multiple cloning site where we can insert the rfp sequence. We therefore carried out the construction by megapriming. BBa_K3788020.
Figure 14: Representation of BBa_K3 788 020. caa: colicin gene, cai: CaI immunity protein gene. The 5’ region of cal sequence containing the cai promoter is fused with the rfg sequence.
pRL1-colA-gfp/rfp-lysis
This last construction (composite part BBa_K3788021) is a merge of the two preceding ones.
We replace caa by gfp and cal by rfp, following the same scheme as for the two previous constructions. The combination of our two constructs will allow us to characterize the different timing of the system; how long will it take for the lysis protein to be produced after GFP production (thus Cal production)?
Figure 15: Schematic view of the pRL1 cola-gfp/rfp-lysis construct and its regulations. caa: colicin A toxin; cai: toxin immunity; cal: lysis protein. rfp replaces the majority of cal with the stop of rfp. The 5' region of cal is conserved to maintain regulatory sequences. gfp replaces the majority of caa. The 3' region of caa is retained in the construct because it contains regulatory sequences.
Toxins to induce tiger mosquitoes’ death
In order to be able to target virus-infected tiger mosquitoes, we had to find the most effective way to kill A. albopictus before the female had time to infect a human by biting it.
On this basis, we were looking for toxins that could be synthesized by bacteria, or bio-insecticides. We were thus able to discover the Cry (Crystal) and Cyt (Cytolytic) toxins of Bacillus thuringiensis (Bt). There are a multitude of these toxins. They stand out from each other by the different domains composing them. This gives them host specificity (a toxin +/- a target insect). The advantage is that they are also biodegradable and harmless to vertebrates (including humans), and plants. In this way, we prevent toxins from having an impact on all of the biodiversity that we want to preserve (15).
Mode of action of Cry toxins
Cry toxins, in the form of a pro-toxin (inactive), will undergo proteolytic cleavage at their N-terminus end, allowing the unmasking of the zone of interaction with the receptor. Mature Cry toxins recognize glycoprotein-type receptors on the surface of midgut cells, more specifically the microvilli of the apical membranes. The II and III domains, forming 3 β-sheets, allow this interaction. Once recognized, domain I, forming 7 amphipathic α-helices, one of which is hydrophobic, is inserted into the membrane to allow the formation of the pre-pore. From this first step emerges the formation of Cry toxins oligomers and the formation of the pore. This allows ion leakage and cell lysis. Following this, an event cascades lead to sepsis resulting in the death of the insect (15, 16).
Mode of action of Cyt toxins
Cyt toxins are produced in a pro-toxin form and, like Cry toxins, Cyt toxin will undergo proteolytic cleavage in N-term and C-term, allowing the release of the active form of Cyt toxins. The mature forms will interact with the membrane lipids of the midgut cells and will insert themselves into the membrane, forming β-barrels (15).Global strategy
Cry11Aa has a toxic action, specific to A. aegypti because its -8 loop, region -4 and domain II loop 3 recognize the mosquito midgut BBMV receptor. It has been shown that Cyt1Aa would facilitate the binding of Cry11Aa to the BBMV receptor. This is enhanced by the interaction of the α8, β4 and loop 2 regions of Cry11Aa, at the level of the loop β6–αE and part of β7 of Cyt1Aa. This interaction allows easy insertion of Cry11Aa into membranes.
In addition, it was discovered in B. thuringiensis, a p20 gene in operon with cry11Aa and cyt1Aa. Thus, the P20 protein was shown to be necessary for the formation of inclusion bodies of Cry11Aa and Cyt1Aa. P20 would allow a greater production of these toxins and allow their stability (Cyt1Aa would be protected from the proteolytic action before its maturation). The co-production of P20 and Cyt1Aa in E. coli would limit its toxic effects in the producer cell. (17).
We chose to work on these two toxins Cry11Aa and Cyt1Aa as well as with the P20 chaperone because they are widely studied and they are particularly effective when used in synergy.
Sequences choice
The coding sequences cry11Aa, cyt1Aa and p20, were gathered from the iGEM19 BGU Israel team parts (respectively Part: BBa_K2938005,Part: BBa_K2938003 and Part: BBa K2938008). All sequences need to be optimized for E. coli K12 and internal sequence restriction sites removed along with tags if they were present.
We wanted to add a sequence encoding a tag for each DNA sequence. The addition of these sequences can have several purposes: a) to easily and cost-efficiently do Western blots using antibodies directed against these tags and b) to perform purification using suitable affinity columns.
To be able to design these parts:
- Part: BBa_K3788000: sequence encoding for tag Strep II in N-ter and Cyt1Aa,
- Part: BBa_K3788001: sequence encoding for tag Flag in N-ter and Cry11Aa,
- Part: BBa_K3788002: sequence encoding for tag 6 histidines in N-ter and P20.
We wanted to design these parts independently, allowing both to have controls (P20 as being a chaperone, it has no identified toxic role), and also to see the independent action of each part of the project.
Indeed, as said previously, the final objective of the project is to obtain a construction allowing the expression of the operon p20-cry11Aa-cyt1Aa (part composite BBa_K3788004) because it would induce a greater toxicity and stability in mosquitoes and a reduced toxicity in the producing bacterium.
In order to be able to construct all of these genes, the sequences had to be ordered. Not being able to directly command the entire operon, it was chosen to separate into two parts:
ATG tgg agt cat cct caa ttt gaa aaa GAA AATCTGAATCATTGCCCATTGGAGGACATCAAGGTGAATCCGTGGAAAACGCCTCAGTCAACTGCCCGTGTGAT CACTTTACGCGTAGAAGATCCGAATGAAATCAACAATCTGCTGAGCATCAATGAGATTGACAATCCGAACTACATCCTCCAAGCCATTATGCTTGCGAATGCGTTCCAAAACGCACTGGTCCCAACGAGCACGGATTTTGGGGA TGCTTTACGCTTTTCCATGCCGAAAGGCCTGGAAATTGCGAACACCATTACGCCTATGGGTGCAGTTGTGTCGTATGTGGATCAGAACGTTACTCAGACCAACAACCAAGTCTCGGTCATGATTAACAAAGTGCTGGAAGTCCT GAAAACTGTACTGGGTGTAGCGTTATCAGGGAGCGTTATTGACCAACTTACCGCAGCGGTTACCAACACCTTTACGAATCTGAACACCCAGAAGAATGAAGCTTGGATCTTTTGGGGTAAAGAAACGGCCAATCAGACCAACTA TACCTACAATGTACTGTTTGCGATTCAGAACGCACAAACAGGAGGCGTGATGTACTGTGTTCCGGTGGGCTTTGAGATCAAAGTGAGTGCGGTTAAAGAACAGGTCCTGTTCTTCACAATCCAGGATAGTGCCAGCTATAACGT GAACATTCAGTCGCTGAAATTCGCTCAACCCCTCGTTAGCTCCTCTCAGTATCCGATTGCCGATTTGACCTCTGCCATTAACGGCACATTG TAA
Legend: in yellow: StrepTag; in green: Start codon; in red: Stop codon.
6hisp20Flagcry11Aa (Part composite: BBa_K3788003) sequence
ATGGGCcaccatcaccatcaCCATACAGAAAATGGAGTATTTTATAAAATATTCACCACCGAGAACAACAACTTCTGCATTAAT CCAACCTTGTTGGAGCGCGTGTTTAAGAACAACTTGGACGAGTTTGATTTTAGCTTAGTGAAGAAAAACCTCGAGCATGAAAAGAACTGCGTGATCACCTCTACGATGAACCA AACCATTTCCTTCGAAAATATGAATAGCACTGAAATGGGCCACAAAACTTACAGCTTCCTGAACCAAACGGTTCTGAATAACAAGGGTAATTCGTCGCTGGAGGAACAGGTGA GCAACATCTTCTATCGTTGCGTTTACATGGAAGTTGGCAAAAGCTCTAGTTACATCAAACCGCTGGAGCAGGATAGCAATAAAATTCGTTATGTTTGTAGCCTTTTGTTTATC GTTCCGTATAAGAACAACATCACCTCTATTATTCCGGTAAATCTGCAACTGACCCTGCTGTCCAAAAACGTGAAGCAGAGCTCCAGCACGAACATCTTCTCCGGTGACATCCA CTTTAATATGGTCACCATGACCTACCTGACCTAAAGGAGGAATAAATAATGGATTATAAAGACGACGATGATAAAGAAGATAGTTCGCTCGATACCCTGAGCATTGTCAACGA AACAGATTTTCCACTCTACAACAACTACACAGAACCGACCATTGCACCAGCGTTGATTGCTGTAGCGCCGATTGCGCAATATCTTGCAACCGCGATTGGTAAATGGGCCGCCA AAGCCGCGTTTTCAAAAGTGCTTTCCCTGATTTTCCCTGGCTCACAACCGGCGACTATGGAAAAGGTCCGTACTGAAGTTGAAACGCTCATCAATCAGAAACTGTCTCAAGAT CGCGTGAACATCCTGAACGCGGAATATCGTGGTATCATTGAAGTTAGCGATGTCTTTGATGCGTACATCAAACAGCCGGGCTTTACTCCGGCTACTGCCAAAGGCTATTTCCT GAATCTGAGTGGTGCTATTATTCAGCGTTTGCCTCAGTTTGAGGTACAGACCTATGAAGGCGTGTCGATCGCGCTGTTTACCCAGATGTGTACCTTACATCTGACGTTACTGA AAGATGGCATCCTCGCTGGCTCCGCTTGGGGTTTTACCCAAGCCGACGTTGACTCTTTCATCAAGCTGTTCAATCAGAAAGTGCTCGATTATCGCACCCGTCTGATGCGGATG TATACCGAAGAGTTTGGGCGCCTGTGCAAAGTGTCGTTAAAAGATGGCCTGACCTTTCGCAATATGTGCAATCTGTATGTGTTCCCCTTTGCAGAAGCGTGGAGCTTAATGCG CTATGAAGGTCTGAAGTTGCAGAGTTCCCTGTCCCTTTGGGACTATGTTGGTGTCTCCATTCCGGTGAATTACAATGAATGGGGTGGTCTGGTCTATAAACTGCTGATGGGTG AAGTGAACCAGCGCCTGACCACCGTTAAATTCAACTACTCCTTTACCAATGAGCCAGCGGATATTCCGGCTCGTGAGAACATTCGCGGTGTGCATCCCATTTACGACCCTTCG TCTGGGTTAACTGGGTGGATTGGCAATGGACGCACGAACAACTTCAACTTTGCCGACAACAATGGCAACGAAATCATGGAAGTCCGTACCCAGACGTTTTACCAAAACCCGAA TAACGAACCCATTGCCCCGCGGGATATCATTAACCAGATTCTGACGGCTCCAGCACCAGCCGACTTGTTCTTCAAGAATGCAGACATCAACGTGAAATTCACGCAATGGTTCC AAAGTACCTTATACGGGTGGAATATCAAACTGGGAACACAGACAGTACTGTCATCACGCACTGGAACAATCCCTCCGAACTATCTGGCCTATGATGGCTACTATATTCGCGCG ATTTCAGCCTGTCCGCGTGGCGTTTCTCTTGCGTATAATCACGATCTCACTACACTGACCTATAACCGCATTGAGTACGATTCTCCCACGACCGAGAACATTATTGTAGGCTT TGCGCCGGACAACACCAAAGACTTCTACAGCAAGAAAAGCCACTACTTAAGCGAAACGAATGACTCTTATGTGATCCCAGCACTTCAGTTTGCCGAAGTATCCGATCGTAGCT TCTTAGAGGATACCCCGGACCAAGCAACCGATGGAAGCATCAAATTTGCTCGTACCTTTATCAGCAACGAGGCGAAGTATTCAATCCGCCTGAATACCGGGTTTAACACGGCA ACGCGCTATAAACTTATTATCCGTGTTCGCGTTCCATACCGTTTGCCTGCGGGTATTCGTGTGCAGTCGCAGAACAGTGGCAATAATCGCATGCTGGGCAGCTTTACTGCGAA CGCCAATCCGGAATGGGTTGATTTCGTGACTGACGCATTTACGTTCAATGATCTGGGTATCACGACTAGCTCGACGAATGCCTTGTTTAGCATCTCGAGTGATTCGCTTAATT CTGGCGAAGAGTGGTACTTGAGCCAACTGTTCCTGGTCAAAGAGAGTGCATTTACGACACAGATTAACCCGTTGCTGAAATAA
Legend: in green: Start codon; in purple: 6his; in blue: RBS; in orange: Distance RBS; in grey Flag; in red: Stop codon.
Global cloning strategy
On the one hand it allows the creation of the operon and on the other hand to compare the effect of Cry11Aa with and without its chaperone.
It would also have been necessary to do the construction with the p20 and cyt1Aa operon, this part was not designed.
BBa_K3788000, BBa_K3788001, BBa_K3788002, BBa_K3788003
The other objective, described under, is to design primers allowing the amplification of the desired sequences with the addition of an end
allowing cloning of the amplified sequence, by recombination, on the vector pBAD24 MSC3 at the NcoI restriction site (allowing the conservation of RBS) by SLIC method.
The BBa_K3788004 cloning strategy was slightly different and will be explained later.
Table 1: Cloning strategy table. The sequences thus ordered can be amplified by PCR using the primer o2111 to o2116 designed. Thus, these sequences might as well be cloned into the vector pBAD24 MSC3 (previously digested with NcoI) by the SLIC cloning method.
At the end of this cloning by SLIC, the following plasmids may be obtained (Figure 16).
Figure 16: Map of the plasmids obtained. a. pBAD24_6hisp20, b. pBAD24_flagcry11Aa, c. pBAD24_strepcyt1Aa, d. pBAD24_6hisp20_flagcry11Aa.
BBa_K3788004
As for the cloning of the part BBa_K3788004 into the plasmid pBAD24 MSC3, the following strategy was thought. The plasmid pBAD24_6hisp20_flagcry11Aa can be used
after a digested withKpnI restriction enzyme and used to insert the gene strepcyt1Aa by recombination by the SLIC cloning method.
Cloning strategy table (continued)
Table 2: Cloning strategy table (continued). Thus, strepcyt1Aa (BBa_K3788000) has to be amplified by PCR with the o2139 and o2135 primers. o2139 contains a flanking end allowing both recombination on the plasmid pBAD24_6hisp20_flagcry11Aa following the cry11Aa gene and the addition of an RBS would allow the expression of the gene strepcyt1A. o2135 also contains a floating end that would allow recombination on the plasmid pBAD24_6hisp20_flagcry11Aa after cry11Aa.
At the end of this cloning by SLIC, the following plasmid may be obtained (Figure 17).
Plasmid map obtained (continued)
Figure 17: Plasmid map obtained (continued). pBAD24_6hisp20_flagcry11Aa_strepcyt1Aa named Toxto.
References
- Grogan, C., Bennett, M., Moore, S. & Lampe, D. Novel Asaia bogorensis Signal Sequences for Plasmodium Inhibition in Anopheles stephensi. Front. Microbiol. 12, 275 (2021).
- Le moustique, colonisateur hors pair. Le Monde.fr (2017).
- EcoTree. Moustiques : leur rôle écosystémique et leurs dangers. EcoTree https://ecotree.green/blog/quelle-est-l-utilite-des-moustiques-dans-la-nature.
- Yamada, Y. et al. Asaia bogorensis gen. nov., sp. nov., an unusual acetic acid bacterium in the alpha-Proteobacteria. Int. J. Syst. Evol. Microbiol. 50, 823–829.
- Crotti, E. et al. Asaia , a versatile acetic acid bacterial symbiont, capable of cross-colonizing insects of phylogenetically distant genera and orders. Environ. Microbiol. 11, 3252–3264 (2009).
- Simão, E. P. et al. Nanostructured impedimetric lectin-based biosensor for arboviruses detection. Talanta208, 120338 (2020).
- Thermodynamics of concanavalin A dimer-tetramer self-association: sedimentation equilibrium studies | Biochemistry.
- Dalbey, R. & Wang, P. Membrane Proteases in the Bacterial Protein Secretion and Quality Control Pathway. Microbiol. Mol. Biol. Rev. MMBR 76, 311–30 (2012).
- Dinh, T. & Bernhardt, T. G. Using Superfolder Green Fluorescent Protein for Periplasmic Protein Localization Studies ▿. J. Bacteriol. 193, 4984–4987 (2011).
- The Auto display Story, from Discovery to Biotechnical and Biomedical Applications
- Escherichia coli strain 2787 plasmid AIDA-associated heptosyltransfera - Nucleotide - NCBI.
- Charbonneau, M.-È., Janvore, J. & Mourez, M. Autoprocessing of the Escherichia coli AIDA-I Autotransporter: A NEW MECHANISM INVOLVING ACIDIC RESIDUES IN THE JUNCTION REGION*. J. Biol. Chem. 284, 17340–17351 (2009).
- Kleiner-Grote, Gabriele R M et al. “Secretion of recombinant proteins from E. coli.” Engineering in life sciences vol. 18,8 532-550. 14 Apr. 2018, doi:10.1002/elsc.201700200.
- Lewin, A., Mayer, M., Chusainow, J., Jacob, D. & Appel, B. Viral promoters can initiate expression of toxin genes introduced into Escherichia coli. BMC Biotechnol. 5, 19 (2005).
- Bravo, A., Gill, S. S. & Soberón, M. Mode of action of Bacillus thuringiensis Cry and Cyt toxins and their potential for insect control. Toxicon 49, 423–435 (2007).
- Hua, G., Masson, L., Jurat-Fuentes, J. L., Schwab, G. & Adang, M. J. Binding Analysis of Bacillus thuringiensis Cry δ-Endotoxins Using Brush Border Membrane Vesicles of Ostrinia nubilalis. Appl. Environ. Microbiol. 67, 872–879 (2001).
- Manasherob, R. et al. Effect of Accessory Proteins P19 and P20 on Cytolytic Activity of Cyt1Aa from Bacillus thuringiensis subsp. israelensis in Escherichia coli. Curr. Microbiol. 43, 355–364 (2001).