Overview
Our results mainly consist of two parts. The first part is about plasmid construction: amplification of VP1, VP1-linker and LTB fragments, amplification and digestion of VP1-LTB fragments, and ligation of VP1 and VP1-LTB fragments with pGEX-6P-1 respectively. The second part is about plasmid transformation: verification of pGEX-6P-1-VP1 and pGEX-6P-1-VP1-LTB and verification of VP1 and VP1-LTB proteins.
Plasmid construction
In this part of the experiment, we amplified VP1 fragments from pUC57-VP1 and LTB fragments from pUC57-LTB, then ligated and inserted them into the vectors pGEX-6P-1, and obtained pGEX-6P-1-VP1 and pGEX-6P-1-VP1-LTB.
·PCR for VP1,VP1-linker and LTB fragments
Firstly, to amplify VP1 fragments and VP1-linker fragments from pUC57-VP1 and LTB fragments from pUC57-LTB, we added VP1-FP and VP1-RP into two tubes to amplify VP1 fragments, VP1-FP and VP1-linker-RP into another two tubes to amplify VP1-linker fragments, and LTB-FP and LTB-RP into another two tubes to amplify LTB fragments.
VP1-FP：
5′-CGGGATCCATGAATAAAGGAGCCATGAAACACC -3′
VP1-RP:
5′-TTCTTCAACATCACCTGCTTGCTTTAGCAGAGAGAAGTTTGTGGCAAGAGTGGTG-3′
VP1-linker-RP:
5′-TAGTGGTGAGAACGGTGTTGAAGAGAGACGATTTCGTTCGTTCGTCCAC-3′
LTB-FP:
5′-TAAAGCAAGCAGGTGATGTTGAAGAAAACCCCGGGCCTGTTGACATATATATAAC-3′
LTB-RP：
5′-GCGTCGACAAGCTTGCCCTCCAGCCTAGC-3′
To confirm whether we successfully amplified the fragments we wanted from the plasmids, we ran the electrophoresis of the fragments in the six tubes. We then scanned the gel, compared the strong bands with the markers, and identified VP1, VP1-linker and LTB fragments on the gel. If we got the expected results, we can extract the three types of fragments from the gel and continue our experiments: digestion of VP1 fragments and OE PCR of VP1-LTB fragments.
Figure 1. Gel electrophoresis of VP1, VP1-linker and LTB fragments after PCR.
Conclusion: Theoretically, VP1 fragment is 891bp in length; VP1-linker fragment is 948bp in length; LTB fragment is 604bp in length. Compared with the markers, the strong bands in the six tubes all fit in the right range, so it proved that our PCR for the three types of fragments was successful, and we could continue our experiments.
·OE PCR for VP1-LTB fragments
After obtaining VP1-linker and LTB fragments from PCR, we overlapped them through OE PCR. We added the two types of fragments, VP1-FP, and LTB-RP into one tube and waited for them to overlap. Then we conducted double digestion on the newly ligated fragments.
To confirm whether we successfully overlapped the two fragments, we ran the electrophoresis of the fragments in the tubes. We then scanned the gel, compared the strong bands with the markers and identified VP1-LTB fragments on the gel. If we got the expected results, we can extract the fragments from the gel and insert them into the vectors.
Figure 2 Gel electrophoresis of VP1-LTB fragments after OE PCR and enzyme digestion
Conclusion: Theoretically, digested VP1-LTB fragment is 1552bp in length. Compared with the markers, the strong band fit in the right range, so it proved that our OE PCR for VP1-LTB was successful, and we could continue our experiments.
·Clonexpress Ligation reaction for pGEX-VP1 and pGEX-VP1-LTB
We had already obtained digested VP1 fragments and VP1-LTB fragments after PCR and OE PCR. In order to insert them into the vectors pGEX-6P-1 respectively, we first needed to use the same restriction enzymes, SalⅠ and BamHⅠ, to digest pGEX-6P-1 and make the plasmids available for ligation. We then run the gel electrophoresis of digested pGEX-6P-1, identified the fragments we wanted, and extracted them from the gel. After that, we conducted ClonExpress ligation reaction to ligate VP1 and VP1-LTB fragments with pGEX-6P-1.
Figure 3 gel electrophoresis of pGEX-6P-1 after double digestion
Conclusion: Theoretically, pGEX-6P-1 after double digestion of SalI and BamHI is 4975bp in length. Compared with the markers, the strong band fit in the right range, so we can continue to conduct ClonExpress ligation reaction for pGEX-6P-1-VP1 and pGEX-6P-1-VP1-LTB.
Simultaneously, we used Snapgene to construct the profiles of the plasmids we constructed, pGEX-6P-1-VP1 and pGEX-6P-1-VP1-LTB. We demonstrated and understood the parts of the plasmids: restriction gene, target gene, and multiple cloning site.
Figure 4. plasmid profile of pGEX-6P-1-VP1 and pGEX-6P-1-VP1-LTB.
Plasmid transformation
In this part, we transformed the plasmids we constructed into E.coli to replicate them, then extracted and verified the plasmids, and transformed them into E.coli and L.casei again. Finally, we verified the expression of VP1 and VP1-LTB proteins in the two types of bacteria.
Verification of transformed plasmids
·Electrophoresis of pGEX-VP1 and pGEX-VP1-LTB
After transforming the plasmids into E.coli DH5α to replicate them, we picked 6 individual colonies from each petri dish and extracted the plasmids from them. To confirm whether the extracted plasmids were the ones we required, we ran a DNA gel electrophoresis of the transformed plasmids; we also run gel electrophoresis of pGEX-6P-1 after single digestion on the same gel as a negative group. We then scanned the gel, compared the brightest DNA bands with the markers, and identifies pGEX-6P-1-VP1 and pGEX-6P-1-VP1-LTB on the gel.
Figure 5. gel electrophoresis of pGEX-6P-1-VP1 and pGEX-6P-1-VP1-LTB
Conclusion: Theoretically, pGEX-6P-1 is 4984 bp long in linear shape; pGEX-6P-1-VP1 is 5853 bp long in linear shape; pGEX-6P-1-VP1-LTB is 6511 bp long in linear shape. The length of plasmids in the form of covalently closed circular DNA (cccDNA) is half of the length of linear-shaped plasmids. Accordingly, pGEX-6P-1, which became linear-shaped after single digestion, should be around 5000bp in length, while both pGEX-6P-1-VP1 and pGEX-6P-1-VP1-LTB, which were in the form of cccDNA, should be around 2500bp in length. Compared with the markers, the plasmids in the twelve groups that we extracted from E.coli DH5α all fit in the right range. Therefore, we reached a preliminary conclusion that we succeeded in the experiments of plasmid transformation and obtained the plasmids we wanted.
·Restriction enzyme double digestion of pGEX-VP1 and pGEX-VP1-LTB
We had tested the plasmids we extracted from E.coli DH5α in terms of their length. To further confirm whether the plasmids carried the fragments we wanted, we used SalⅠ and BamHⅠ to cut off the fragments between their cutting sites from pGEX-6P-1-VP1 and pGEX-6P-1-VP1-LTB; simultaneously, we conducted single digestion on each group as the negative control group. Then we run the gel electrophoresis of the digested plasmids to separate and identify the fragments cut off from the plasmids.
Figure 6. gel electrophoresis of pGEX-6P-1-VP1 and pGEX-6P-1-VP1-LTB after double digestion
Conclusion: Theoretically, VP1 fragment is 891bp in length; LTB fragment is 604bp in length；pGEX-6P-1 after double digestion by SalⅠ and BamHⅠis 4975 in length. Compared with the markers, samples 3 and 4 of pGEX-6P-1-VP1 were both correct, and sample 3 of pGEX-6P-1-VP1-LTB was correct as well. However, in sample 4 B+S(pGEX-6P-1-VP1-LTB after double digestion by SalⅠ and BamHⅠ), the weaker bands, which should represent the VP1-LTB fragments, did not appear on the gel, so we recognized the plasmids transformation in sample 4 of pGEX-6P-1-VP1-LTB as a failure. We discarded this sample and sent the samples that were proved right after enzyme digestion to a company for sequencing.
·Sequencing for VP1 and VP1-LTB fragments on transformed plasmids
After enzyme digestion and gel electrophoresis of pGEX-6P-1-VP1 and pGEX-6P-1-VP1-LTB, we tentatively confirmed that the experiment of plasmid transformation into E.coli DH5α was successful, and we obtained the plasmids we wanted. To further verify whether there was any mutation in VP1 and VP1-LTB fragments on the plasmids, we needed to obtain and compare the upstream and downstream sequences of the two fragments.
-Sequencing results is placed at the end of this page
Conclusion: VP1-F-sequencing and VP1-R-sequencing, VP1-LTB-F-sequencing and VP1-LTB-R-sequencing, were both complementary with each other according to the base pair rule. Therefore, we confirmed that there were no mutation sites in VP1 and VP1-LTB fragments and the plasmids we extracted from E.coli DH5α were correct.
Verification of VP1 and VP1-LTB expression
After receiving the sequencing results, we had confirmed that E.coli DH5α successfully carried and replicated the plasmids we constructed. The next part of our experiments is to transformed the plasmids that were verified to be correct into E.coli BL21 and L. paracasei ATCC334 respectively and then to verify the protein expression in them.
Verification of protein expression in E.coli BL21
Due to the relatively low rate of growth and efficiency of electroporation of L. casei, our team first transformed E.coli BL21, which is commonly used in plasmids transformation, to verify the expression and antigencity of VP1 and VP1-LTB proteins.
·SDS-PAGE and Coomassie Brilliant Blue staining for whole bacteria, supernate, and precipitation
We transformed pGEX-6P-1-VP1 and pGEX-6P-1-VP1-LTB into E.coli BL21 respectively and incubated them. Firstly, we ran a PAGE gel of the whole bacteria, supernate, and precipitation of E.coli BL21 and then stained the gel through Coomassie Brilliant Blue Staining.
Figure 7. PAGE gel of GST, GST-VP1 and GST-VP1-LTB after staining (W: whole bacteria; S: supernatant; P: precipitation)
Conclusion: After Coomassie Brilliant Blue Staining, we found that the extent of the brightness of the band in the P group was comparable to that in the W group, while the band in the S group was nearly invisible. In other words, GST, GST-VP1 and GST-VP1-LTB had all been successfully expressed by E.coli BL21, and they mainly existed in the precipitation in the form of inclusion body.
·SDS-PAGE and Western Blot for further verification
We also ran another PAGE gel of L. casei and then conducted Western Blot on it. After that, we scanned the gel and analyzed the expression of VP1 and VP1-LTB in E.coli BL21 further.
Figure 8. PAGE gel of GST, GST-VP1 and GST-VP1-LTB after WB
Conclusion: Using primary and secondary antibodies, we successfully located GST, GST-VP1, and GST-VP1-LTB. However, the brightness of GST-VP1 bands and GST-VP1-LTB bands was much lower than that of the GST bands. This means that the expression of VP1 and VP1-LTB was not so effective in E.coli BL21, so we needed to further probe into the optimum conditions under which E.coli BL21 could express GST-VP1 and GST-VP1-LTB the best.
·Expression optimization
In order to find the optimum condition under which the proteins were expressed the most, we selected bacteria solution of different concentration (OD600=0.5/0.6/0.8/1), and inducted them with IPTG solution of different concentration(IPTG=1mM/10mM). Then we ran a PAGE gel of them and then marked the proteins with Coomassie Brilliant Blue Staining Solution. To visualize and compare the expression of proteins under different conditions, we used the software ImageJ to quantify specific bands on the gel, collected and arranged the data, and constructed a broken line graph with OD600 the x- axis and the gray value as the y-axis.
Figure 9. PAGE gel of GST, GST-VP1 and GST-VP1-LTB under different expression conditions
Figure 10. Model
Conclusion: Via this graph of model, we determined the optimum expression conditions of VP1 and VP1-LTB respectively in E.coli BL21: VP1 was expressed the most under OD600=0.5, IPTG=10mM; VP1-LTB was expressed the most under OD600=0.8, IPTG=1mM. Besides, we could see that when OD600 was over 0.8, the expression of VP1-LTB proteins was significantly higher than that of VP1 proteins in E.coli BL21. This meant that LTB could promote the expression of VP1 in E.coli BL21 during its late growth period.
Verification of protein expression in L. paracasei ATCC334
·Colony PCR
In order to verify whether the plasmids we constructed had been successfully transformed into L. casei ATCC334, we conducted colony PCR on the bacteria solution and the ran a gel electrophoresis of it.
Figure 11. gel electrophoresis of VP1 and VP1 fragments after colony PCR
Conclusion: As the graph of the gel showed, we successfully amplified VP1 and VP1-LTB fragments from the plasmids carried in L. casei, which meant that L. casei successfully carried the plasmids.
Next, we ran a PAGE gel of L. casei to further confirm whether they had expressed the plasmids they carried. Then we stained and scanned the gel.
Figure 12. PAGE gel of GST, GST-VP1 and GST-VP1-LTB after staining
Conclusion: After staining and scanning the gel, we did not find any obvious bands in certain KD ranges, which meant there was no obvious expression of GST-VP1 and GST-VP1-LTB in L. casei.
Future plans
We combined VP1 and LTB to construct the recombinant expression system and used E.coli to express the proteins. We detected the protein expression with IPTG solution of different concentration at different growth stage, constructed related models, and determined the optimum expression conditions. All these laid a solid foundation for the development of HFMD oral vaccine.
-
Currently, we just verified the viability of our concept and determined the optimized condition of protein expression in E.coli. However, because of the difficulty in protein expression inL.casei, we would need to optimize the incubation and electroporation of L.casei, or improve and reconstruct the plasmids, to realize the expression of GST-VP1-LTB in L.casei.
-
If L.casei did express the proteins after the improvement of our design, the next part of our project would be that we let the mice take the transformed L.casei via gavage, and then measured the level of anti-VP1-LTB IgG in the serum of the mice and the level of IgA in their feces. Finally, we could verify immunogenicity of our oral vaccine.
Reference
-
Wang, H., & Li, Y. (2019). Recent Progress on Functional Genomics Research of Enterovirus 71. Virologica Sinica, 34(1), 9–21. https://doi.org/10.1007/s12250-018-0071-9
-
Li, C. Y., Wang, Y., Gu, Y. L., Gu, Y. N., Chen, H. Y., Tian, L., Chen, L. Y., & Peng, T. (2012). Xi bao yu fen zi mian yi xue za zhi = Chinese journal of cellular and molecular immunology, 28(9), 956–959.
-
Wu, S. C., Liu, C. C., & Lian, W. C. (2004). Optimization of microcarrier cell culture process for the inactivated enterovirus type 71 vaccine development. Vaccine, 22(29-30), 3858–3864. https://doi.org/10.1016/j.vaccine.2004.05.037
-
Chen, H. L., Huang, J. Y., Chu, T. W., Tsai, T. C., Hung, C. M., Lin, C. C., Liu, F. C., Wang, L. C., Chen, Y. J., Lin, M. F., & Chen, C. M. (2008). Expression of VP1 protein in the milk of transgenic mice: a potential oral vaccine protects against enterovirus 71 infection. Vaccine, 26(23), 2882–2889. https://doi.org/10.1016/j.vaccine.2008.03.041
-
Huda, M. N., Ahmad, S. M., Alam, M. J., Khanam, A., Kalanetra, K. M., Taft, D. H., Raqib, R., Underwood, M. A., Mills, D. A., & Stephensen, C. B. (2019). Bifidobacterium Abundance in Early Infancy and Vaccine Response at 2 Years of Age. Pediatrics, 143(2), e20181489. https://doi.org/10.1542/peds.2018-1489
-
Yi, E. J., Shin, Y. J., Kim, J. H., Kim, T. G., & Chang, S. Y. (2017). Enterovirus 71 infection and vaccines. Clinical and experimental vaccine research, 6(1), 4–14. https://doi.org/10.7774/cevr.2017.6.1.4
-
7.Yu, X. F., Pan, J. C., Meng, D. M., Wang, H. Q., Zhang, W., & Zheng, W. (2007). Zhonghua yu fang yi xue za zhi [Chinese journal of preventive medicine], 41(6), 461–465.
Sequencing results
>VP1-F-sequencing
ATCTGTTCCAGGGGCCCCTGGGATCTCCATGGGGATCCATGGGAGATAGGGTGGCGGATGTGATTGAGAGTTCTATAGGGGATAGTGTGAGCAGAGCTCTCACCCAAGCTTTACCAGCACCCACAGGCCAAAACACGCAAGTAAGCAGCCACCGGTTGGACACTGGTAAAGTCCCAGCACTCCAAGCCGCTGAAATTGGAGCATCATCAAATGCTAGTGACGAGAGTATGATTGAGACACGGTGTGTTCTCAACTCGCACAGTACAGCTGAAACTACCCTCGATAGTTTTTTTAGCAGAGCGGGGCTAGTTGGAGAGATAGACCTCCCCCTTGAAGGCACAACCAACCCGAATGGTTATGCCAACTGGGACATAGATATAACAGGCTATGCACAAATGCGTAGAAAGGTGGAGTTGTTCACCTACATGCGTTTTGACGCAGAGTTCACCTTTGTTGCATGTACACCCACCGGGGAGGTTGTCCCACAATTGCTCCAATATATGTTTGTGCCACCTGGGGCTCCCAAGCCAGACTCCAGAGAATCCCTTGCATGGCAAACTGCCACCAACCCCTCGGTTTTTGTTAAGTTGTCAGATCCCCCAGCACAGGTTTCGGTTCCATTCATGTCACCCGCAAGCGCCTATCAATGGTTCTATGACGGATACCCCACGTTCGGTGAGCACAAGCAAGAGAAAGACCTTGAATATGGGGCATGTCCAAACAATATGATGGGCACGTTCTCAGTGCGAACTGTGGGAACCTCGAAGTCCAAGTACCCTTTGGTGATTAGGATTTACATGAGGATGAAGCACGTCAGGGCGTGCATACCCCGTCCAATGCGTAACCAAAACTATCTATTCAAAGCCAACCCAAATTATGCCGGCACTCCATTAAGCCAACCGGTACCAGCCGCACGGCGATCAACACTTCTTTAGGTCGACTCGAGGATACAAGGACGATGACGATAAGTGAGCGGCCGCATCGTGACTGACTGACGATCTGCCTCGCGCGTTTCGGTGATGACGGTGAAAACCTCTGACCACATGCAGCTCCCGGGAGACGGTCCACAGCTTGTCTTGTAA
>VP1-R-sequencing
GGCAGATCGTCAGTCAGTCACGATGCGGCCGCTCACTTATCGTCATCGTCCTTGTAATCCTCGAGTCGACCTAAAGAGTGGTGATCGCCGTGCGGCTGGTACCGGTTGGCTTAATGGAGTTGCCGGCATAATTTGGGTTGGCTTTGAATAGATAGTTTTGGTTACGCATTGGACGGGGTATCCACGCCCTGACGTGCTTCATCCTCATGTAAATCCTAATCACCAAAGGGTACTTGGACTTCGAGGTTCCCACAGTTCGCACTGAGAACGTGCCCATCATATTGTTTGGACATGCCCCATATTCAAGGTCTTTCTCTTGCTTGTGCTCACCGAACGTGGGGTATCCGTCATAGAACCATTGATAGGCGCTTGCGGGTGACATGAATGGAACCGAAACCTGTGCTGGGGGATCTGACAACTTAACAAAAACCGAGGGGTTGGTGGCAGTTTGCCATGCAAGGGATTCTCTGGAGTCTGGCTTGGGAGCCCCAGGTGGCACAAACATATATTGGAGCAATTGTGGGACAACCTCCCCGGTGGGTGTACATGCAACAAAGGTGAACTCTGCGTCAAAACGCATGTAGGTGAACAACTCCACCTTTCTACGCATTTGTGCATAGCCTGTTATATCTATGTCCCAGTTGGCATAACCATTCGGGTTGGTTGTGCCTTCAAGGGGGAGGTCTATCTCTCCAACTAGCCCCGCTCTGCTAAAAAAACTATCGAGGGTAGTTTCAGCTGTACTGTGCGAGTTGAGAACACACCGTGTCTCAATCATACTCTCGTCACTAGCATTTGATGATGCTCCAATTTCAGCGGCTTGTAGTGCTGGGACTTTACCAGTGTCCAACCGGTGGCTGCTTACTTGCGTGTTTTGGCCTGTGGGTGCTGGTAAAGCTTGTGTGAGAGCTCTGCTCACACTATCCCCTATAGAACTCTCAATCACATCCGCCACCCTATCTCCCATGGATCCCATGGAGATCCCAGGGGCTCCTGGAACAGACTTCCAGATCCGATTTTGGAGATGGTCGCCACCACCAAACGTGGCCTTG
>VP1-LTB-F-sequencing
TGGAAGTTCTGTTCCAGGGGCCCCTGGGATCTCCATGGGGATCCATGGGAGATAGGGTGGCGGATGTGATTGAGAGTTCTATAGGGGATAGTGTGAGCAGAGCTCTCACCCAAGCTTTACCAGCACCCACAGGCCAAAACACGCAAGTAAGCAGCCACCGGTTGGACACTGGTAAAGTCCCAGCACTCCAAGCCGCTGAAATTGGAGCATCATCAAATGCTAGTGACGAGAGTATGATTGAGACACGGTGTGTTCTCAACTCGCACAGTACAGCTGAAACTACCCTCGATAGTTTTTTTAGCAGAGCGGGGCTAGTTGGAGAGATAGACCTCCCCCTTGAAGGCACAACCAACCCGAATGGTTATGCCAACTGGGACATAGATATAACAGGCTATGCACAAATGCGTAGAAAGGTGGAGTTGTTCACCTACATGCGTTTTGACGCAGAGTTCACCTTTGTTGCATGTACACCCACCGGGGAGGTTGTCCCACAATTGCTCCAATATATGTTTGTGCCACCTGGGGCTCCCAAGCCAGACTCCAGAGAATCCCTTGCATGGCAAACTGCCACCAACCCCTCGGTTTTTGTTAAGTTGTCAGATCCCCCAGCACAGGTTTCGGTTCCATTCATGTCACCCGCAAGCGCCTATCAATGGTTCTATGACGGATACCCCACGTTCGGTGAGCACAAGCAAGAGAAAGACCTTGAATATGGGGCATGTCCAAACAATATGATGGGCACGTTCTCAGTGCGAACTGTGGGAACCTCGAAGTCCAAGTACCCTTTGGTGATTAGGATTTACATGAGGATGAAGCACGTCAGGGCGTGTATACCCCGTCCAATGCGTAACCAAAACTATCTATTCAAAGCCAACCCAAATTATGCCGGCAACTCCATTAAGCCAACCGGTACCAGCCGCACGGCGATCACCACTCTTGCCACAACTTCTCTCTGCTAAAGCAAGCAGTGATGTTGAAGAAAACTCCGGGCCTGTTGACATATATACAGATTCCGGGATGAATTATGATAAG
>VP1-LTB-R-sequencing
CCGCGAGGCAGATCGTCAGTCAGTCACGATGCGGCCGCTCACTTATCGTCATCGTCCTTGTAATCCTCGAGTCGACAAGCTTGCCCCTCCAGCCTAGCTTAGTTTTTTCTGTGTGCTATAACAGCTCCCTGTAGTGGAAGCTGTTATAGTGTTACAGTTTAAGGATCGGTATTGCCTCCTCTACCGCCTTTTCAAATGCAGCATAAGGCTCATTAGTATAAGTACAGTAGTTGTTATATAGGTTCCTAGCATTAGACATGCTTTTAAAGCAAACTAGTTTTTCATACTGATTGCCGCAATTGAATTGGGGGTTTTATTATTCCATACACATAATTTATCAATTTTGGTCTCGGTCAGATATGTGATTCTTAATGTGTCCTTCATCCTTTCAATGGCTTTTTTCTGGGAGTCTATATGTTGACTGCCCGGGACTTCGACCTGAAATGTTTCGCCGCTCTTAAATGTAATGATAACCATTTCTCTTTTGCCTGCCATCGATTCCGTATATGATAGTATCTTGTCATTTATCGTATATATTTGTGTGTTGCGATATTCCGAACATAGTTCTGTAATAGTCTGGGGAGCTCCGTGTGCATATAGAGAGGATAGTAACGCCGTAAATAAAACATAACATTTTACTTTATTCATAATTCATCCCGAATTCTGTTATATATGTCAACAGGCCCGGGGTTTTCTTCAACATCACCTGCTTGCTTTAGCAGAGAGAAGTTTGTGGCAAGAGTGGTGATCGCCGTGCGGCTGGTACCGGTTGGCTTAATGGAGTTGCCGGCATAATTTGGGTTGGCTTTGAATAGATAGTTTTGGTTACGCATTGGACGGGGTATCCACGCCCTGACGTGCTTCATCCTCATGTAAATCCTAATCACCAAAGGGTACTTGGACTTCGAGGTTCCCACAGTTCGCACTGAGAACGTGCCCATCATATTGTTTGGACATGCCCCATATTCAAGGTCTTTCTCTTGCTTGTGCTCACCGAACGTGGGGTATC