Team:NNU-China/Part/EngineeringSuccess
1. Construction of the library of BL21 (DE3)-derived variant strains by Base Editor
CRISPR-mediated DNA base editor are promising tool that can yield point mutations at desired sites without generating a DNA double-strand break or requiring a donor DNA template. It has been reported that the base editor can be applied to Corynebacterium glutamicum[1], Bacillus subtilis[1],Saccharomyces cerevisiae[2] and E. coli MG1655[3]. The cytosine base editor (CBE), consisting of dSpCas9, CDA, UGI and LVA, has been tested in E. coli MG1655,3 with a high editing efficiency of 87.2%. Therefore, the CBE was designed to build the RBS library of T7 RNAP in BL21 (DE3) firstly.
1.1 Yielding the starting strain of BL21 (DE3)-RBS8G
Firstly, to achieve the editing of the RBS sequence using CBE, a tailored RBS sequence of 5'-GGGGGGGG-3' was integrated into the corresponding site of the T7 RNAP, yielding a starting strain of BL21 (DE3)-RBS8G. Here, the CRISPR/Cas9 system was used to construct the BL21 (DE3)-RBS8G strain. The pCas and pTarget plamids was provided by our PI, Xiao-Man Sun. In the genome of BL21 (DE3), the CCGGATTTACTAACTGGAAG was chosen as N20 sequence, and then the pTarget-8G plasmid was successfully constructed based on the pTarget (Fig. 1).
Results: By sequencing, the RBS sequence of T7RNAP on the genome was successfully replaced by GGGGGGGG (Fig. 2), which indicated that the starting strain BL21 (DE3)-RBS8G was successfully constructed.
1.2 Building and testing the dual plasmids system of CBE
Then, the dual plasmids system of CBE was designed, built and tested. The pCBE plasmid contains the lambda operator, cytidine deaminase, Uracil DNA glycosylase inhibitor and LVA degradation labels. Based on the pCas, the pCBE (BBa_K3868097) was successfully constructed (Fig. 3A). To extend the editing range, two different sgRNA expression frames were tandemly linked, allowing GGGGGGGG to be covered, resulting in a more diverse editing outcome. Based on the pTarget, the pTargetS plasmid (BBa_K3868098) was successfully constructed (Fig. 3B), and the sequences of sgRNA1 and sgRNA2 was showed in Fig. 3C. The CBE / sgRNA complex can bind to the double-stranded DNA to form an R-loop in a sgRNA and PAM-dependent manner. CDA catalyzes the deamination of cytosines located at the top (non-complementary) strand within 15–20 bases upstream from PAM, which results in C-to-T mutagenesis.3
Results:During construction of the library, 90 single colonies were randomly selected for sequencing. It was found that 48 variants with different RBS sequence were identified from 90 samples, with an editing efficiency of only 53%. However, it is noteworthy that the transformants were grown on the solid medium for longer time, the reproducibility of the results gradually increased, and majority of variant RBS sequences became GAAAAAAG (Fig.4), probably due to the continuous base editing in the transformants. The above results show that although CBE possesses the advantages of simplicity and rapidity, editing results and efficiency applied in BL21 (DE3) are not sufficiently stable.
2. Construction of the BL21 (DE3)-derived Variant Strains Library by CRISP/Cas9
In order to improve the number of BL21 (DE3)-derived variant strains with different RBS sequence of T7RNAP, the more mature CRISPR-Cas9 technology was chosen to supplement it. Under the guide of sgRNA, the Cas9 protein can generate the double-strand breaks, which can be repaired using donor DNA by homologous recombination in BL21 (DE3). Therefore, the new different RBS sequences can be introduced in the Donor DNA, then it can be integrated into the genome to produce a library of BL21 (DE3)-derived variant strains.
2.1 Constructing the Donor DNA plasmids library
Firstly, the donor DNA was inserted into the plasmid of pTarget, yielding the pTarget+Donor (Fig.5). Then, the donor library containing different RBS sequences was constructed using the using megawhop PCR.
Results: The Donor DNA plasmids library containing different RBS sequence was obtained.
2.2 Yielding the starting strain of BL21 (DE3)-CM
There are two LacI expression frames in the genome of BL21 (DE3), which may lead to homologous recombination by RecA[4], so the related lacI operator gene in DE3 region need to be replaced by the antibiotic gene of chloramphenicol (CM) (Fig. 6A). Importantly, the gene of CM can also be used as secondary screening pressure to remove false positive strains.
Results: The lacI gene in DE3 region was successfully replaced by CM gene (Fig. 6B and 6C).
2.3 Constructing the Library of BL21 (DE3)-derived Variant Strains
In this part, we still takes the dual plasmid expression system for genome editing. The sgRNA on the pTarget+Donor was designed to target the gene of CM (Fig.7A). The pCas and pTarget+Donor plasmids were co-transformed into BL21 (DE3)-CM via electroporation, then the single colonies were cultivated in LB medium with CM and non-CM, respectively. The transformants that cannot grow under CM condition were considered correct ant used for further sequencing (Fig.7B).
Results: Results showed that a total of 284 single colonies were grown on 10 plates, of which 90 were randomly selected for sequencing analysis (Fig. 7C). Surprisingly, 71 different variants were identified from 90 simples, which indicated the efficiency of obtaining variants is up to 78.9%. It was hypothesized that roughly 224 different variants could be obtained from approximately 284 single colonies, reaching 87.5% of the theoretical values (28=256). Compared to the CBE method, it is clear that the CRISPR-Cas9 system is more efficiently edited and more suitable for the construction the BL21 (DE3)-derived variant strains library, despite both the same transformation method and screening time.
Fig. 7. A. The schematic diagram of pTarget+Donor and the composite part of BBa_K3868099 . B. The whole process of constructing the library of BL21 (DE3)-derived variant strains using CRISPR/Cas9. C. The partial sequences and the G and A abundance variation maps of RBS variants obtained by CRISPR from three batches respectively.
3. Development of High Throughput Host Screening Platform and its Application in AMPs
Based on the library of BL21 (DE3)-derived variant strains, the high throughput host screening platform for recombinant protein production was constructed (Fig. 8). In this system, the target recombinant protein was fused with the eGFP and was transferred into the BL21 (DE3)-derived variant strains library, then the best host was screened by fluorescence intensity in 96-well plates. Using this platform, it takes only 3 days to obtain the highest-expression host. In order to test this platform, the hard-to-express protein of GDH was used.
3.1 Construction of the plasmid of pET-SMAP-eGFP
Based on the plasmid of pET-24a, the C-terminal of SMAP was fused with eGFP in order to characterize the yield of SMAP. The pET-24a was provided by our PI. Moreover, in order to purify the AMP, the enzyme loci of thrombin was inserted between AMP and eGFP, and the label of 6*His was inserted at the end of eGFP, yielding the plasmid of pET-SMAP-eGFP. The fluorescence intensity of eGFP could be used to indicate the expression level of AMPs. As the proof of concept, pET- SMAP-eGFP was produced, and cells showed a distinct green color after 12h (Fig. 9).
3.2 Application of the high throughput host screening platform in SMAP production.
By the high throughput host screening platform, three better strains was selected from 96-well for improving the SMAP[5] production (Fig. 10A). Furthermore, three strains of SMAP-30, SMAP-35, SMAP-50 were selected and cultivated in shake flask. The results showed that the expression of SMAP in SMAP-50 was enhanced by 35.29-fold than that of BL21 (DE3) (Fig. 10B). The result showed that this platform can improve the yield of target AMPs more conveniently and quickly.
[1] Wang Y, Cheng H, Liu Y, Wen X, Zhang K, Ma Y. In-situ generation of large numbers of genetic combinations for metabolic reprogramming via CRISPR-guided base editing. Nature communications. 2021; 12(1): 1-12.
[2] Gong G, Zhang Y, Wang Z, Liu L, Shi S, Siewers V, Yuan Q, Nielsen J, Zhang X, Liu Z. GTR 2.0: GRNA-tRNA array and Cas9-ng based genome disruption and single-nucleotide conversion in Saccharomyces cerevisiae. ACS synthetic biology. 2021; 10: 1328–1337.
[3] Zhao D, Li J, Li S, Xin X, Hu M, Price MA, Rosser SJ, Bi C, Zhang X. Glycosylase base editors enable C-to-A and C-to-G base changes. Nature Biotechnology. 2021; 39: 35–40.
[4] Schlegel S, Löfblom J, Lee C, Hjelm A, Klepsch M, Strous M, Drew D, Slotboom DJ, De Gier JW, Optimizing membrane protein overexpression in the Escherichia coli strain Lemo21 (DE3). Journal of molecular biology. 2012; 423: 648–659.
[5] Bagella L, Scocchi M, Zanetti M. cDNA sequences of three sheep myeloid cathelicidins. FEBS Letters. 1995; 376: 225–228.
