Team:IISER Kolkata/Experiments
![[preloader image]](https://static.igem.org/mediawiki/2021/d/d6/T--IISER_Kolkata--image-preloader.gif)
Loading . . .
pUC19:
This is a high copy number plasmid. The origin of replication of this plasmid is pMB1 (High Copy Mutant). This contains Ampicillin resistance gene. This plasmid was mainly used for determining the transformation efficiency of our competent cells. We got this plasmid from one of our sponsors
NEB.
pSB1C3:
pSB1C3 vector is a high copy number plasmid which carries Chloramphenicol resistance gene. The origin of replication is pUC19 derived pMB1. We got this plasmid from iGEM headquarters as this plasmid is a common vector for all the Biobricks present in iGEM-21 kit plates. We used this plasmid as a vector for all the cloning and assemblies.
Eicsm6 Coding Region:
GAATTCGCGGCCGCTTCTAGATGAAAATCCTGTTCTCTCCTATAGGAAATACGGACCCGTGGCGGAACGATCGAGACGGCGCAATGTTACATATTGTACGACATTATCAGCCCGATCGCGTTGTTTTGTTCTTCACTGAAAGCATATGGCAGGGCAACCAGCATTTCTCTGGGCAGCAGGCATTCGACTGGGTCAAGATTATACAATCAATCAATGAAAACTGCCAAATAGAGATCAAGTGCGACACGATAGAAGTCGAAAACGACTTTGACGCTTATAAGGACTTATTTCACCAATATCTCGTTGAAGAGAAGCGCAAGTACCCAAACGCCGAGATCTTTCTGAACGTAACCTCAGGTACCCCACAAATGGAGACGACACTGTGTCTCGAGTACGTAACCTATCCGGATAAGATGAGATGTATCCAAGTGAGTACTCCACTGAAAACCTCAAACGCGAAGACGAAGTATGCCCAGGCAGACTGTCAAGAGGTAGATTTGGAGATTGTAAACGAGGAAGAAAGCCAACAGCCGAGCCGGTGCCATAAAATTGCCATCCTCTCATTCAGAGAGGCCATTGTCAGAAACCAAATTAAGTCCCTGCTGGACAACTATGATTATGAGGCAGCTTTGCAGCTGGTCGCTAGTCAGAAGTCCTTTCGTAACGGTAAAGAGATCAGAAAGAAACTTAAGGAACTTATTGACGATATCAAAATGCACCGCGTTTTCAGTTATCTGATAAAGCAATACCCGCGTAATGAGAAACTTCAGAAGGCCCTTCTCCATACGATCCTGTTGGAGATGCGCCATCAGCGCGGCGATATAGCTGAGACATTAATTCGCGTTAAGTCAATCGCTGAGTACATTGTTGAGCAGTACATACAGAAGAATTACCCCTACCTCATTATTTACAAGGAAGATAAACCGTATTTTAATGTCTCGTATTCCCAGGAACTCACTGAATCGTACCTGGCGTTAATGGATTCCCGAAATAAGAAAACGAATAAGAAGATGACTGTAGATAGCCTCGACCGGATACTGGGATTCCCGGCCTATCGGGACTTTCTTCAGTTGCTCGAGGCGAGTAATGAAATGACAAATGAAATGAACAAGGTCAACGAGATCAACAATCTGCGGAACAAAGTGGCACACAATTTGGATAGCTTGAACCTCGACCGCGATAAGAACGGCCGTAAGATTACTAACGCAGTGACCGCTGTTCGTACTATGCTCCTTGCTGTGTTTCCTGAAGTGCAAGAGAATGATTTTCACTACCTCAAACAGTTCAACCAATCCATCAAGGAGCTGCTTTAATACTAGTAGCGGCCGCTGCAG
Eicsm6 Composite part:
GAATTCGCGGCCGCTTCTAGAGCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACATACTAGAGAAAGAGGAGAAAATGAAAATCCTGTTCAGTCCTATCGGTAATACTGACCCCTGGCGTAACGATCGTGACGGAGCAATGCTTCATATTGTCCGCCATTATCAGCCCGATCGGGTTGTTCTGTTCTTCACAGAATCTATATGGCAGGGTAACCAGCATTTTAGCGGGCAGCAGGCATTCGACTGGGTTAAGATTATACAATCTATAAATGAAAATTGCCAAATAGAGATAAAGTGCGACACGATCGAAGTCGAAAACGACTTTGACGCGTATAAGGACCTCTTTCACCAATATCTTGTTGAAGAGAAGCGCAAGTACCCAAACGCCGAGATATTTCTTAACGTAACCAGTGGTACCCCACAAATGGAGACGACGCTGTGTTTAGAGTACGTCACCTATCCAGATAAGATGCGGTGTATACAAGTGTCAACGCCACTCAAAACCTCGAACGCAAAGACGAAGTATGCACAGGCTGACTGTCAAGAGGTCGATTTGGAGATTGTGAACGAGGAAGAAAGCCAACAGCCGTCCCGTTGCCATAAAATTGCCATACTCTCCTTCCGAGAGGCGATTGTGCGCAACCAAATTAAGAGCCTCTTGGACAACTATGATTATGAGGCTGCATTGCAATTAGTGGCCTCTCAGAAATCCTTTCGGAACGGAAAAGAAATACGTAAGAAATTGAAGGAACTTATAGATGATATCAAAATGCACCGCGTCTTTTCCTATCTGATTAAGCAATACCCTCGGAATGAAAAGTTGCAGAAGGCGTTACTTCATACTATCCTGCTGGAGATGCGCCATCAGCGGGGCGATATAGCGGAGACCTTGATTCGCGTTAAATCCATAGCCGAGTACATTGTAGAGCAGTACATTCAGAAGAATTACCCGTACCTTATAATTTATAAAGAGGATAAACCATACTTCAATGTGTCGTATAGCCAGGAATTAACCGAGTCATACTTAGCCCTCATGGATTCGCGTAATAAGAAAACGAATAAGAAGATGACGGTCGATTCATTAGACCGCATTCTGGGTTTCCCTGCCTATCGTGACTTTCTGCAACTCCTGGAAGCAAGTAATGAAATGACGAATGAAATGAACAAGGTGAACGAGATAAACAATCTGCGGAACAAAGTAGCACATAACTTAGACAGTCTTAATTTAGATCGTGACAAGAATGGTCGCAAAATCACGAATGCGGTAACTGCGGTGCGCACCATGCTGTTGGCGGTCTTCCCAGAGGTTCAGGAAAACGACTTCCATTATTTAAAGCAATTTAATCAGAGCATTAAAGAACTTTTGCATCACCATCACCATCACTAACCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAG
DNaseI basic:
GAATTCGCGGCCGCTTCTAGATGCGTGGAACAAGACTTATGGGATTACTCCTTGCGTTAGCAGGCCTTTTACAACTCGGGCTTAGTCTGAAAATTGCGGCATTTAATATTCGAACTTTCGGCGAAACGAAAATGTCAAACGCGACTTTAGCGTCCTATATAGTGCGAATAGTACGGCGCTATGATATTGTACTTATTCAAGAAGTACGTGATAGTCATTTGGTAGCCGTCGGCAAACTGCTTGATTACTTGAATCAAGACGATCCTAATACTTATCATTACGTTGTGAGCGAACCCTTAGGTCGTAATTCCTATAAGGAACGTTACCTTTTCTTGTTTCGTCCGAATAAAGTCTCGGTTTTGGATACGTATCAATATGATGATGGTTGTGAATCATGTGGTAATGATTCTTTTAGTCGCGAACCAGCCGTCGTGAAATTTTCTTCACATTCGACAAAAGTAAAAGAGTTCGCTATAGTGGCACTTCATTCTGCACCGTCCGATGCCGTCGCAGAAATCAACAGCCTGTATGACGTGTATCTCGACGTGCAACAAAAGTGGCATCTGAATGACGTTATGCTTATGGGAGACTTTAACGCCGATTGTTCCTATGTTACGTCAAGTCAATGGTCTAGTATACGTCTCCGGACCAGTAGCACATTTCAATGGTTAATCCCAGATTCCGCTGATACAACTGCGACCTCAACTAATTGTGCGTACGATCGCATTGTAGTTGCTGGAAGCCTTCTGCAATCTTCAGTAGTCCCAGGTTCAGCAGCCCCTTTCGACTTCCAAGCTGCATACGGACTGAGCAATGAGATGGCCCTGGCCATCAGTGACCATTACCCGGTGGAGGTGACGCTGACATAATACTAGTAGCGGCCGCTGCAG
DNase1 composite:
GAATTCGCGGCCGCTTCTAGAGCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACATACTAGAGAAAGAGGAGAAAATGCGGGGTACACGTTTGATGGGTTTACTCCTGGCTTTGGCCGGCTTGCTCCAATTGGGACTTAGTCTTAAAATTGCCGCGTTTAATATACGTACATTCGGCGAAACTAAAATGTCTAACGCCACATTGGCTTCTTATATCGTGCGTATTGTTAGACGATATGATATTGTGTTGATTCAAGAAGTTCGTGATAGTCATTTGGTTGCCGTCGGCAAACTTTTAGATTACCTTAATCAAGACGATCCGAATACATATCATTACGTTGTGTCCGAACCTTTGGGGAGAAATTCTTATAAAGAACGGTATCTTTTCCTGTTTCGACCGAATAAAGTTAGCGTACTCGATACTTATCAATATGATGATGGGTGTGAAAGCTGTGGCAATGATTCTTTTAGCCGTGAACCGGCAGTCGTAAAATTTAGTTCACATTCGACTAAAGTGAAAGAGTTCGCAATAGTCGCATTACATTCTGCACCGTCTGATGCTGTCGCGGAAATCAACTCGTTATATGACGTGTATTTAGACGTTCAACAGAAATGGCATTTAAATGACGTTATGCTGATGGGTGACTTTAACGCGGATTGTTCTTATGTCACGTCTTCTCAATGGTCTAGTATTAGACTTCGGACTTCAAGTACTTTTCAATGGTTAATCCCAGATAGCGCAGATACAACCGCCACCTCAACCAATTGTGCTTACGATCGGATAGTCGTTGCGGGTAGTCTCTTACAATCTAGCGTTGTCCCGGGATCAGCGGCCCCGTTCGATTTTCAGGCCGCTTATGGTTTGAGTAACGAAATGGCACTTGCAATTAGCGATCACTATCCCGTTGAAGTAACCTTGACCTAACCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATATACTAGTAGCGGCCGCTGCAG
NisinPV Coding Sequence:
GTGCAACCTTGGGTAGGCTTTACTTAGCTAAAGGCCTTAGGGGATGGAATTCGCGGCCGCTTCTAGATGTCGACCAAGGACTTCAATCTGGACCTTGTTAGCGTCAGTAAGAAGGACTCCGGAGCGTCTCCGCGGATAACGTCAATATCTCTTTGCACCCCTGGCTGCAAGACTGGCGCGCTCATGGGATGCAATATGAAGACTGCGACCTGCCACTGCCCGGTCCATGTCTCTAAGTAATACTAGTAGCGGCCGCTGCAGCATCGTTTACTTGACTGAAAAGGGGCCTTCTCAAATTGG
P2 + GFP :
ATTAAATACAAATTACATTTAACAGTTAAGTATTTATTTCCTACAGTTAGGCAATATAATGATAAAAGATTGTACTAAATCGTATAATGACAGTGAAAAGAGGAGAAAATGCGCAAGGGCGAGGAGTTGTTTACAGGCGTGGTTCCGATCTTGGTCGAGCTTGACGGAGACGTAAACGGTCATAAGTTCAGCGTGTCCGGGGAAGGCGAGGGCGACGCTACCTATGGCAAGTTAACGCTGAAGTTCATCTGTACGACCGGTAAGCTTCCGGTCCCCTGGCCTACTTTGGTTACAACCTTTGGATACGGGGTGCAGTGTTTCGCACGATATCCGGACCACATGAAGCAACACGATTTCTTTAAATCAGCAATGCCAGAGGGATACGTTCAAGAGCGCACCATTTTCTTTAAGGACGATGGCAATTATAAAACGAGAGCAGAGGTAAAATTCGAGGGAGACACGTTAGTGAACCGAATTGAATTGAAGGGAATCGACTTCAAAGAGGACGGCAATATCCTCGGCCATAAGTTAGAGTATAATTACAATAGTCATAACGTGTACATAATGGCTGATAAGCAGAAGAACGGCATTAAGGTAAACTTTAAGATCCGTCATAACATCGAGGACGGCTCGGTACAGCTGGCTGATCACTACCAGCAGAACACGCCTATCGGAGACGGACCGGTTTTGCTTCCTGATAATCACTATCTTTCTACCCAGAGTGCATTGTCAAAGGACCCTAATGAGAAACGCGATCATATGGTATTGTTGGAGTTCGTCACCGCAGCGGGCATAACTCACGGTATGGACGAGCTGTATAAGTAATAACCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATAGCTTTCGAAGGCTTAGGCGGGAG
AgrA + terminator:
AAAGAGGAGAAATACTAGATGGAGATTGCCTTGGCGACTGACAACCCCTACGAAGTATTAGAGCAAGCGAAGAATATGAATGATATTGGTTGTTACTTCCTTGACATCCAATTATCCACAGATATAAATGGAATAAAGCTCGGAAGCGAGATACGCAAGCACGACCCAGTGGGCAATATCATCTTTGTCACGTCCCACTCCGAATTGACATACTTAACCTTTGTGTATAAAGTGGCCGCGATGGACTTTATATTCAAGGATGACCCTGCCGAATTGCGCACACGTATAATTGATTGCTTAGAGACAGCTCATACTCGGCTTCAGTTGCTTAGCAAGGACAATAGCGTTGAGACAATCGAGCTTAAGCGCGGGAGTAATTCGGTGTATGTGCAGTACGACGACATTATGTTCTTTGAGAGTTCTACAAAATCTCATCGCTTAATTGCACACCTTGACAACAGACAAATAGAATTTTACGGAAACCTTAAGGAATTATCACAACTGGACGACAGATTCTTTCGGTGCCACAATAGTTTTGTGGTGAACAGACATAATATTGAGAGCATTGATTCAAAGGAAAGAATAGTCTATTTTAAGAATAAAGAGCATTGCTACGCAAGCGTGCGGAACGTAAAGAAGATTTAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTAT
pBAD + AgrC:
ACATTGATTATTTGCACGGCGTCACACTTTGCTATGCCATAGCAAGATAGTCCATAAGATTAGCGGATCCTACCTGACGCTTTTTATCGCAACTCTCTACTGTTTCTCCATACCGTTTTTTTGGGCTAGCAAAGAGGAGAAAATGATCCTTATGTTTACAATCCCTGCGATCATCTCAGGAATCAAATATTCAAAATTGGACTACTTCTTTATTATTGTTATAAGTACGTTATCATTATTCCTCTTTAAGATGTTTGACAGTGCTTCTTTGATAATTCTCACCAGCTTTATTATTATTATGTACTTTGTGAAGATCAAGTGGTACTCGATTCTCCTGATAATGACAAGCCAAATAATTTTGTATTGCGCAAATTATATGTACATAGTAATTTATGCATATATTACTAAGATTTCTGACTCAATATTTGTCATTTTCCCAAGCTTCTTCGTAGTATACGTAACTATATCGATCTTATTCAGTTACATCATTAACCGGGTATTGAAGAAAATTTCCACACCCTATTTAATCTTAAATAAGGGGTTCTTGATTGTTATTTCAACAATATTGCTCTTGACGTTTAGCCTTTTCTTCTTCTATTCCCAAATAAATTCGGACGAAGCGAAGGTGATTAGGCAATATTCTTTTATTTTCATCGGCATAACAATTTTCCTCTCAATCCTCACGTTTGTGATTAGCCAATTTCTTCTGAAGGAGATGAAATATAAACGGAATCAGGAAGAGATTGAAACATACTACGAATATACGTTGAAAATAGAGGCTATTAATAATGAGATGCGGAAGTTCCGCCATGATTATGTCAATATCCTTACGACGCTTTCAGAGTATATTCGCGAGGATGATATGCCGGGATTACGCGACTACTTTAATAAGAATATAGTACCTATGAAGGACAATCTTCAGATGAATGCCATCAAATTAAATGGCATTGAGAATCTTAAGGTTCGGGAAATTAAAGGCTTGATAACAGCAAAGATTTTGAGAGCCCAAGAGATGAATATTCCGATCTCAATTGAGATTCCGGATGAGGTGAGCTCGATCAATTTAAATATGATAGATTTAAGCAGATCAATTGGGATTATTTTGGATAATGCAATTGAGGCGAGCACAGAGATTGATGATCCTATCATCCGTGTAGCGTTCATTGAATCGGAAAATTCGGTCACATTCATTGTCATGAATAAGTGTGCCGATGACATTCCTCGAATCCATGAGCTCTTTCAAGAGTCCTTTTCCACAAAAGGCGAGGGCAGAGGGCTCGGGTTGAGTACATTGAAGGAAATTGCAGACAATGCTGATAATGTGCTCTTGGATACAATAATTGAGAATGGCTTCTTCATCCAAAAGGTTGAGATTATTAACAATTAATAA
Primers for normal PCR:
-
Amplification of biobrick part
Primer type Sequence % GC Tm Length Forward 5’-gatggaattcgcggccgcttcta-3’ 56.5 61.7 23 Reverse 5’-gatgctgcagcggccgctactagta-3’ 60 64.4 25 -
Linearized plasmid backbone synthesis
Primer type Sequence % GC Tm Length Forward 5’- gtgctgcagtccggcaaaaaa-3’ 52.4 59.3 21 Reverse 5’-gtgaattccagaaatcatccttagcg-3’ 42 66 26 -
Sequencing primers
Primer type Sequence % GC Tm Length Forward(VF2) 5’-tgccacctgacgtctaagaa-3’ 50 60 20 Reverse(VR) 5’-attaccgcctttgagtgagc-3’ 50 60 20
Primers specific for Hi-Fi DNA assembly:
-
For Unidirectional Assembly
Pbad_RBS_AgrC_fwd_uni 5’-tctggaattccaacattgattatttgcacgg-3’ Pbad_RBS_AgrC_rev_uni 5’-tttctcctctttttattaattgttaataatctcaaccttttg-3’ RBS_AgrA_fwd_uni 5’ taacaattaataaaaagaggagaaatactagatg 3 RBS_AgrA_rev _uni 5’ tttgtatttaattataaacgcagaaaggcc 3 P2_GFP_fwd_uni 5’ttctgcgtttataattaaatacaaattacatttaacagttaagtatttatttcctacagttag 3’ P2_GFP_rev_uni 5’ ggactgcagcacctcccgcctaagccttcg 3’ PSB1C3_fwd_uni 5’ gcttaggcgggaggtgctgcagtccggcaaaaaag 3’ PSB1C3_rev_uni 5’ aaataatcaatgttggaattccagaaatcatccttagcg 3’ -
For Bidirectional Assembly
Pbad_RBS_AgrC_fwd_bi 5’- tttgtatttaatacattgattatttgcacgg-3’ Pbad_RBS_AgrC_rev_bi 5’-tttctcctctttttattaattgttaataatctcaaccttttg-3’ RBS_AgrA_fwd_bi 5’ taacaattaataaaaagaggagaaatactagatg 3 RBS_AgrA_rev _bi 5’ ggactgcagcactataaacgcagaaaggcc 3 P2_GFP_fwd_bi 5tctggaattccactcccgcctaagccttcg 3’ P2_GFP_rev_bi 5’aaataatcaatgtattaaatacaaattacatttaacagttaagtatttatttcctacagttag 3’ PSB1C3_fwd_bi 5’ ttctgcgtttatagtgctgcagtccggcaaaaaag3’ PSB1C3_rev_uni 5’ gcttaggcgggagtggaattccagaaatcatccttagcg 3’
E. coli DH5α: This strain is used for only cloning and assembly of different gene fragments.
E. coli BL21: This strain is used for study expressions.
Pseudomonas aeruginosa: This strain is used for performing the Biofilm assay.
0.5 M EDTA stock solutions
For preparation of 30ml stock solution
- Weigh out 5.583 grams of EDTA disodium salt.
- Dissolve in 25ml of milli Q water and adjust pH with solid NaOH to reach the pH of 8
- Add 5ml milli Q water to make the total volume to 30ml
- Autoclave for 15mins at 121 °C
50X TAE Buffer
For preparation of 250ml solution
- Weigh out 60.5g Tris base and dissolve approximately in 200ml milli Q water
- Carefully add 14.275ml of 100% glacial acetic acid
- Add 25ml of 0.5 M EDTA (pH 8)
- The pH of buffer should be around 8.5
- Store at room temperature
10X TAE Buffer working solution
Add 20ml of 50X TAE buffer to 1000ml of milliQ water.
1M NaOH preparation for pH adjustments
To prepare 20ml of 1M NaOH add 0.8g of NaOH pellets in 20ml of dH2O. Then store it in a falcon tube.
Crystal Violet solution preparation
For 1L solution
- Add 1g of crystal violet to 1000ml of dH2O and then do the magnetic stirring for solubilising.
Antibiotics Stock and working solutions
As per the requirement, the stock and working concentrations can be made by referring to the corresponding concentrations provided in the table below.
Download AntibioticsConcentrations.csv
Stock for Primers
- Check the concentrations of each primer provided by the vendor
-
Need to make the stock concentration of 100pm/μl
- Centrifuge the empty vials at 30,000 rpm for 30 secs.
- Heat the NFW at 95°C for 10mins then at 55°C for 30 mins
- Pour the NFW to the mentioned volume to make the stock concentration (100pm/μl) in each tube of primer. Remember to perform this step inside the hood.
- Leave the tubes in 4°C for 4-5 hrs.
- Take it out from 4°C and mix by soft pipetting or light vortex. Then store it at -20°C.
- For making a working concentration of 10pm/μl add 10μl of stock solution to 90 μl of NFW.
Resuspension of biobricks from iGEM kit Plates
- Label the plates properly and carefully with a marker (for reference check the well contents from iGEM website)
- Take 10μl of NFW using a micropipette. Punch a hole in the aluminum foil for the well you want to resuspend with the tip of the micropipette tip.
- Slowly release the water into the well.
- Gently pipette inside the well for a few times. The solution will be red due to the presence of cresol dye.
- Keep the mixture there for 5 mins
- Now transfer it to a PCR tube and store it in -20°C. Label it properly before storing
Resuspension of DNA fragments ordered from Twist Bioscience -
- Briefly centrifuge the tube and resuspend the DNA in NF-tris EDTA (TE Buffer), pH 8 or 10mM Tris HCl, pH 8 to the desired concentration.
- A concentration of 10ng/μl is recommended for a stock solution.
- Prepare aliquots of the stock and make working aliquots.
- For long-term storage, freeze DNA at -20°C or -80°C
DNaseI stock preparation
Lyophilized form of Bovine DNaseI was obtained from sigma aldrich (D2025-15KU). Resuspension and stock preparation was done as per the guidelines from the company:
- Lyophilized form which contains approximately 5 mg of DNaseI was resuspended in 0.15M NaCl solution making up to a concentration of 5mg/ml.
- Working concentrations were made by diluting it further in 0.15M NaCl or Media directly.
- Stock solution was stored in -20 ℃ to prevent degradation.
Introduction
Preparing competent cells of Ecoli KRX,BL21
Materials
TFB-1(pH-5.1) for 30 ml
10 mM RbCl - 0.36 g
50 mM MnCl2 - 0.19 g
30 mM CH3COOH+ - 0.08 g
100 mM CaCl2 - 0.03 g
15 % glycerol - 4.5 ml
TFB-2(pH-6.8) for 15 ml
10 mM MOPS -0.031 g
10 mM RbCl-0.012 g
15 mM CaCl2-0.124 g
15 % glycerol-2.25 ml
Procedure
STEPS
- Pick a single colony of cell and inoculate in 10 ml of LB
- Grow it overnight at 37 ° C overnight by shaking
- Add 1 ml of overnight grown culture to 100 ml of pre warmed LB broth in 500 ml flask
- Shake on and grow at 37 ° C till the OD reached 0.5
- Cool the culture on ice for 5 min and then transfer culture to round bottom centrifuge tube(Falcon)
- Collect the cells by centrifugation(5 min,4000g) at 4° C
- Discard the supernatant and keep the cells on ice
- Resuspend the cells on a cold TFB-1 buffer(30 ml) and inoculate on ice for 90 min.
- Collect the cells by centrifugation(5 min,4000g, 4 ° C)
- Discard the supernatant and keep cells on ice.
- Resuspend the cells in 4 ml of ice cold TFB-2.
- Prepared 50 to 100 ml aliquots in 1.5 ml centrifuge tube
- keep all those tubes in -80°C.
-
Set up the following reaction in a microcentrifuge tube on ice. (T4 DNA Ligase should be added last. The molar ratio of insert: plasmid is 3:1 in the below table .) We used NEBioCalculator to calculate molar ratios.
The table below is given for 20ul Reaction
Competent T4 DNA Ligase Buffer (10X)(Should be thawed and resuspended in room temperature) 2 μl Vector DNA (4 kb) 50 ng (0.020 pmol) Insert DNA (1 kb) 37.5 ng (0.060 pmol) Nuclease-free water to 20 μl T4 DNA Ligase 1ul - The reaction is gently mixed by pipetting up and down and microfuge briefly.
- For cohesive (sticky) ends, it is incubated at 16°C overnight.
- For blunt ends or single base overhangs, it is incubated at 16°C overnight.
- The mixture is heat-inactivated at 65°C for 10 minutes.
- The mixture is chilled on ice and transformed 1-5 μl of the reaction into 50 μl competent cells.
We have assembled 4 fragments (including plasmid backbone) using NEB HiFi DNA Assembly kit. We have calculated the numbers of picomoles of each fragment using the NEBiocalculator.
Set Up the reaction mixture of 50 microliter
| Recommended DNA Molar Ratio | vector:insert = 1:1 |
| Total Amount of Fragments | 0.2–0.5 pmols** X μl |
| NEBuilder HiFi DNA Assembly Master Mix | 10 μl |
| Deionized H2O | 10-X μl |
| Total Volume | 20 μl |
|---|
Introduction
Transfer of miniprep plasmids or Ligation mixture into Escherichia coli KRX or BL21
Materials
- Ice
- Competent cells
- Ligation mixture or miniprep plasmids
- SOC media
- Hot water bath
- Incubator
- Timer
- Agar plates
- cell spreader
- Bunsen burner
- Laminar air flow hood
Procedure
The following steps are to be followed in order -
- Take out the competent cells (100μl/50μl) from -80°C storage and place in ice.
- Add ligation mixture (10μl) or miniprep Plasmids (1 or 2 μl) to the 100μl competent cells by pipetting. While pipetting make sure that the tip of the micropipette tips does not come in contact with the competent cells. Close the tube and mix them by gently tapping on the side of the tube.
- Keep the tube in ice from 30 mins.
- In the meantime switch on the hot water bath and set the temperature to 42°C and also keep the SOC media in the incubator at 37 °C.
- Place the tube in a floating rack and then heat shock it for 45 seconds at 42°C, use a timer for accurate measurements of time.
- Now put the tube immediately into ice and keep it for 5 mins.
- Then add SOC media to make up the volume to 1000μl and incubate it for 1.5 hours in shaking condition at 37°C.
- In the meantime keep the agar plates at room temperature.
- Post incubation takes 100 μl from the tube and then spreads it with a cell spreader. Then take the rest of the contents of the tube and centrifuge it at 10,000 x g for 3 mins, pour out the maximum supernatant and then mix the cell pellets with the leftover supernatant with a pipette and again spread it on another agar plate. Store the plate in an incubator at 37°C for 12-16 hours.
Initially method of biofilm formation in 96 well plate was standardised by using different choices of media ,incubation conditions ,dilutions and incubation times.The following is the optimised protocol for maximum yield of biofilm:
The effect of DNaseI on biofilm of Pseudomonas aeruginosa is studied using 96 well microtiter experiments. To optimize the concentration of DNaseI required for treatment, the effect of a gradient of DNase I in the range of 0–50 µg/mL was studied. As a negative control for the experiment, uninoculated wells containing media and diluent were treated similarly and readings obtained were subtracted from the test readings. Positive control wells containing inoculated media without DNaseI were considered as “Control A595 nm”.The biofilm percentage reduction is then calculated as:
$$ BPR = \left( \frac{Control \ A595 nm - test \ A595 nm}{Control \ A595 nm} \right) \times 100 $$Inorder to determine the optimum concentration and time for DNase I treatment,we did assay at two levels:
-
Pretreatment
It was done to determine the optimum concentration of DNaseI which gives maximum degradation.
- A serial dilution of DNaseI (0-25 µg/ml) was prepared in NB media.
- Primary cultures were directly diluted to this media and added to 96 well plates as per the procedure mentioned in above protocol.
-
The layout used is as follows:
- Biofilm was allowed to develop in the presence of DNase1 for 72 hrs.
- Plates were washed and processed as per the procedure mentioned in above protocol.
- Absorbance was measured at 595 nm to quantify biofilm.
- Biofilm percentage reduction at different concentrations were compared and analysed.
-
Posttreatment
This was done to determine the optimum time required for maximum biofil degradation for the optimal concentration determined by pretreatment.
- Pseudomonas biofilm was allowed to develop in 96 well plates for 72 Hrs as per the protocol mentioned before.
- Well constituents,particularly bacteria, were then washed off in dH20.
- Media containing optimum concentration determined by pretreatment was then added into each well and incubated for different times ranging from 0-50 min.
- Plates were further processed by adding Crystal violet followed by Acetic acid.
- Biofilm quantification was carried out at 595nm.
- Biofilm percentage reduction was calculated and further analysed.
- One LB agar plate containing bacteria with a unidirectional circuit and another LB agar plate with a bidirectional circuit containing bacteria were obtained.
- Primary cultures of both the bacteria were given separately in 10ml of LB agar containing Chloramphenicol.
- The culture was incubated overnight at 37 degrees celsius.
- 25ml of fresh LB media (Chl+) was added in 250 ml autoclaved conical flasks.
- Half of the flasks were inoculated with 1ml of the primary culture of the unidirectional circuit containing bacteria each, while the other half were inoculated with 1ml of primary culture each of bidirectional circuit containing bacteria.
- The flasks were incubated at 37 degrees celsius till 0.6 OD (600nm) was reached.
- Flasks were induced with different concentrations of Aip molecules.
- To check the fluorescence, Polystyrene Nunc black 96-well fluorescence plate was obtained.
- 100ul of samples from each flask was added to the 96-well plate in triplicates. 100ul of LB media was added to each well to dilute the samples.
- 200ul of LB media was added to three wells as a negative control.
- The fluorescence was measured in a plate reader, where excitation wavelength was set at 395nm and fluorescence wavelength was measured at 509nm.
- All the flasks were incubated at 30 degrees celsius to allow protein expression.
- The fluorescence was measured at different time points.