Team:CCU Taiwan/Result
Team:CCU iGEM/Result
Loading...
Click the button to get more information about result.
Part A
Part B
Part C
Part D
Part E
Part F
Part G
Part H
Part I
Part A: Producing TAT-eGFP and eGFP proteins for cell penetration assay
Major experiments:
1. Cloning TAT-eGFP and eGFP into pET15b expression vector
2. Expressing TAT-eGFP and eGFP protein
3. Purifying TAT-eGFP and eGFP protein
4. Performing cell penetration ability test
Achievement:
Confirming that TAT-eGFP can penetrate into macrophages.
Cloning TAT-eGFP and eGFP into pET15b expression vector
The pET21a-TAT-eGFP vector was brought from addgene. To express eGFP proteins, we cloned eGFP from pET21a-TAT-eGFP by PCR using a primer pair with selected restriction enzyme sites. The amplicon contains a complete coding region of eGFP.
The primer pair for eGFP is listed below:
XhoI-GFP-F: CTCGAGATGGTGAGCAAGGGCGA
BamHI-GFP-R: GGATCCTTACTTGTACAGCTCG
The PCR amplicon was then digested with restriction enzymes XhoI and BamHI, and ligated into a pET15b vector. The colonies grown after standard transformation were examined by colony PCR using a primer pair recognizing T7 promoter and T7 terminator. The size of the target amplicon of colony PCR is 987 bp in length (Figure 1).
▲ Figure 1: The colony PCR result of pET15b-eGFP cloning.
The inserted eGFP were then confirmed by Sanger sequencing (Figure 2).
▲ Figure 2: The electrogram shows the Sanger sequencing result of pET15b-eGFP.
Expressing TAT-eGFP and eGFP protein
We then transformed pET15b-eGFP and pET21a-TAT-eGFP into E. coli BL21 strain and induced protein expression through culturing bacteria in TB medium with 1 mM IPTG at 37 °C for 2 hr. The induced samples were collected by centrifugation (Figure 3).
▲ Figure 3: The green color of eGFP in IPTG-induced cells was shown.
We then perform SDS-PAGE and coomassie blue staining to confirm the protein expression in induced cells. The predicted size of eGFP protein is 26 kDa and TAT-eGFP is 28 kDa. The staining result clearly showed the induction of eGFP and TAT-eGFP proteins (Figure 4 and 5).
▲ Figure 4: The coomassie blue staining showed the induction of eGFP proteins.
▲ Figure 5: The coomassie blue staining showed the induction of TAT-eGFP proteins.
To optimize the protein expression, we performed the time course examination. The protein expression was induced by culturing bacteria in TB with 1 mM IPTG at 37 °C or at 20 °C, and 0.4 mM IPTG at 20 °C. The bacterial samples were collected every 30 mins. All collected samples were subjected into SDS-PAGE analysis and coomassie blue staining (Figure 6 and 7).
▲ Figure 6: The coomassie blue staining of SDS-PAGE showed the eGFP protein expression at indicated condition.
▲ Figure 7: The coomassie blue staining of SDS-PAGE showed the TAT-eGFP protein expression at indicated condition.
According to the staining result, we found that the eGFP and TAT-eGFP protein expression was saturated around 6 hr. However, the expressed protein may stay in the inclusion body, which is hard to purify. Therefore we disrupt the induced bacteria to examine the location of induced protein (Figure 8 and 9).
▲ Figure 8: The coomassie blue staining of SDS-PAGE showed the eGFP protein expression in soluble or insoluble fraction at the indicated conditions.
▲ Figure 9: The coomassie blue staining of SDS-PAGE showed the TAT-eGFP protein expression in soluble or insoluble fraction at the indicated conditions.
According to the staining result, we found that the supernatant from induced cells at 20 °C and 6 hr induction has the highest eGFP and TAT-eGFP protein expression. Therefore, we decided to induce eGFP and TAT-eGFP protein expression at 20 °C for 6 hr.
Purifying TAT-eGFP and eGFP protein
To ensure that our protein could be purified by nickel column, we first did a small batch of protein purification. The supernatant from induced cells was incubated with nickel-agarose beads, and the unbound protein was extensively washed out by PBS. The elution was performed by 150 mM Imidazole in PBS. All samples of each step were subjected into SDS-PAGE analysis and coomassie blue staining (Figure 10 and 11).
▲ Figure 10: The coomassie blue staining of SDS-PAGE showed the eGFP protein purified by incubating with nickel-agarose beads.
▲ Figure 11: The coomassie blue staining of SDS-PAGE showed the TAT-eGFP protein purified by incubating with nickel-agarose beads.
The results of small scale protein purification showed that the eGFP and TAT-eGFP protein has high affinity to nickel-agarose and is elutable. We then performed FPLC to purify the eGFP and TAT-eGFP protein. The supernatant from induced cells was incubated with the nickel column and unbound protein was first washed out (the fractions 1-5 in Figure 12 and 13). We then add Imidazole (the green line in Figure 12A and 13A) to elute target proteins. With the increase of Imidazole concentration, the protein with weak affinity to nickel column was washed out (the fractions 9-19 in Figure 12 and 13). The eGFP and TAT-eGFP protein, which has high affinity to nickel column, was eluted during fractions 23-36 (Figure 12 and 13). Finally, we collected the fractions 23-31 and exchanged the Imidazole solution to PBS buffer for the following experiments by buffer exchange column.
▲ Figure 12: The FPLC purification and SDS-PAGE examination of eGFP expression. (A) The UV absorbance at different time points during imidazole elution. (B) The SDS-PAGE and coomassie blue staining of fractions collected during imidazole elution.
▲ Figure 13: The FPLC purification and SDS-PAGE examination of TAT-eGFP expression. (A) The UV absorbance at different time points during imidazole elution. (B) The SDS-PAGE and coomassie blue staining of fractions collected during imidazole elution.
Performing cell penetration ability test
a. differentiated U937 cells into macrophages:
The cell line U937 is monocytes, which can be differentiated into macrophages through adding Phorbol 12-myristate 13-acetate (PMA, Sigma-Aldrich). To know the optimal PMA concentration for macrophage differentiation, we referenced the previous report and tested 12.5 nM, 25 nM and 50 nM PMA stimulation for 2 days. If the differentiation is completed, the cells will transform from non-adherent cells to tightly adherent cells, and lead to macrophage-like morphology. The result shows that in the presence of 12.5 nM of PMA, the cell's condition is best (Figure 14).
▲ Figure 14: The phase contrast image showed the cell morphology after PMA stimulation.
b. incubated macrophages with eGFP and TAT-eGFP:
After we differentiated macrophages, we then incubated macrophages with medium containing 200 nM eGFP or TAT-eGFP for 1 hr. The excess eGFP/TAT-eGFP was washed out, and cells were fixed for ICC staining. The ICC image shows that the TAT-eGFP can be transported into macrophages, while eGFP control cannot. The result suggested that TAT has the ability to carry cargos into cells (Figure 15).
▲ Figure 15: The ICC staining result of actin and eGFP expression in differentiated U937 cells. The differentiated U937 cells incubated with the medium containing eGFP or TAT-eGFP were fixed and ICC-stained with actin (red) and eGFP (green). The nuclei (blue) was counterstaining by DAPI. Scale bar was shown.
Part B: Producing proteins for thrombin release experiments
To examine the release rate of TAT-DPK-060, DPK-060 and D2A21 from CBD proteins by thrombin, we constructed plasmids expressing the CBD-grGFP (mimicking TAT), CBD-gkGFP (mimicking DPK-060) and CBD-faGFP (mimicking D2A21) proteins.
Major experiments:
1. Cloning CBD from the human cDNA library
2. Cloning grGFP, gkGFP and faGFP from pET21a-eGFP
3. Ligating CBD-grGFP, CBD-gkGFP, and CBD-faGFP into pET32a
4. Inducing the mimic CBD-GFP protein expression
Achievement:
All constructs in this part are finished and subjected to protein expression.
Cloning CBD from the human cDNA library
To clone the CBD from the human cDNA library, we designed a PCR primer pair recognizing the domains I6-II1-II2-I7 of FN1. We further add the BamHI site to the forward primer, and add a linker sequence and EcoRI site to the reverse primer.
BamHI-CBD-F: GGATCCATGGGCCACTGTGTCACA
EcoRI-Linker-CBD-R: GAATTCGCCGCCGCTGCCGCCGCCGTAGGCAATGCATGTCCAT
The PCR result is shown in Figure 1:
▲ Figure 1: The agarose gel electrophoresis showed the indicated amplicons.
The amplicon of CBD is 651 bp in length as expected. We then perform TA cloning and colony PCR to select the TA vector with right amplicon size (Figure 2).
▲ Figure 2: The agarose image shows the colony PCR result of ligation of CBD with TA vector.
The selected clones were then confirmed by Sanger sequencing (Figure 3).
▲ Figure 3: The electrogram shows the Sanger sequencing result of TA-CBD-linker.
Cloning grGFP, gkGFP and faGFP from pET21a-eGFP
To generate the CBD-GFP mimic proteins, we designed GFP forward primers with modified thrombin sites at 5’ terminals and performed PCR to add the modified thrombin sites onto GFPs. Of note, the CBD-grGFP was ordered from IDT.
EcoRI-TsGK-eGFP-F: GAATTCCTGGTGCCGCGTGGCAAAGTGAGCAAGGGCG
EcoRI-TsFA-eGFP-F: GAATTCCTGGTGCCGCGTTTTGCGGTGAGCAAGGGCG
HindIII-eGFP-R: AAGCTTTTACTTGTACAGCTCGTCCAT
The PCR result is shown in Figure 4:
▲ Figure 4: The agarose gel electrophoresis showed the indicated amplicons.
The amplicons of gkGFP and faGFP are 747 bp in length as expected. We then perform TA cloning and colony PCR to select the TA vector with right amplicon size (Figure 5).
▲ Figure 5: The agarose image shows the colony PCR result of ligation of faGFP and gkGFP with TA vector.
The selected clones were then confirmed by Sanger sequencing (Figure 6 and 7).
▲ Figure 6: The electrogram shows the Sanger sequencing result of TA-gkGFP.
▲ Figure 7: The electrogram shows the Sanger sequencing result of TA-faGFP.
Constructing CBD-grGFP, CBD-gkGFP, and CBD-faGFP into pET32a
The sequence confirmed gkGFP and faGFP in TA vector were then excised by EcoRI and HindIII digestion, while CBD in TA vector was excised by BamHI and EcoRI digestion (Figure 8). The pET32a was digested by BamHI and HindIII. All excised products were purified by gel purification and prepared for ligation.
▲ Figure 8: The agarose gel electrophoresis showed restriction enzyme digestion of TA vectors.
We then ligated CBD with gkGFP, grGFP and faGFP into the pET32a vector, and performed colony PCR to select the right clone. We used a primer pair recognizing CBD and T7 terminator to perform colony PCR. The size of the target amplicon was as expected (Figure 9).
▲ Figure 9: The agarose gel electrophoresis showed colony PCR results of pET32a-CBD-gkGFP, pET32a-CBD-grGFP, and pET32a-CBD-faGFP.
CBD-GFP Protein expression
To express the CBD-GFP proteins, we transformed pET32a-CBD-grGFP, pET32a-CBD-gkGFP and pET32a-CBD-faGFP into BL21, and induced protein expression through adding 1mM IPTG at 37°C for 8 hr. We then performed SDS-PAGE and coomassie blue staining to confirm the protein expression. The predicted size of CBD-GFP proteins is 69.6 kDa (Figure 10). Of note, the induction of CBD-grGFP protein expression was not efficient.
▲ Figure 10: The coomassie blue staining showed the induction of CBD-GFP proteins.
To optimize the protein expression, we performed the cell disruption at different induced time points. The protein expression was induced by culturing bacteria in TB with 1 mM IPTG at 37°C or at 20°C, and 0.4 mM IPTG at 20°C. The bacterial samples were collected every 2 hrs. All collected samples were subjected into SDS-PAGE analysis and coomassie blue staining. As the result is shown, the CBD-faGFP and CBD-gkGFP protein expression was detected in the pellet in all conditions, suggesting the location of the inclusion body (Figure 11). Therefore, we decided to purify CBD-faGFP and CBD-gkGFP from the inclusion body by the urea solution. To optimize the protein expression, we performed the cell disruption at different induced time points. The protein expression was induced by culturing bacteria in TB with 1 mM IPTG at 37°C or at 20°C, and 0.4 mM IPTG at 20°C. The bacterial samples were collected every 2 hrs. All collected samples were subjected into SDS-PAGE analysis and coomassie blue staining. As the result is shown, the CBD-faGFP and CBD-gkGFP protein expression was detected in the pellet in all conditions, suggesting the location of the inclusion body (Figure 11). Therefore, we decided to purify CBD-faGFP and CBD-gkGFP from the inclusion body by the urea solution.
▲ Figure 11: The coomassie blue staining of SDS-PAGE result showed the location of CBD-faGFP and CBD-gkGFP protein expression.
For the CBD-grGFP, we performed the cell disruption to bacteria cultured in TB with 1 mM IPTG at 37°C for 8 hr. The collected sample was subjected into SDS-PAGE analysis and coomassie blue staining. As the result is shown, the protein was expressed in the supernatant. We then did a small batch of protein purification by nickel agarose beads (Figure 12).
▲ Figure 12: The coomassie blue staining of SDS-PAGE showed the CBD-grGFP protein expression in soluble or insoluble fraction at the indicated conditions.
The supernatant from induced cells was incubated with nickel-agarose beads, and the unbound protein was extensively washed out by PBS. The elution was performed by 150 mM Imidazole in PBS. All samples of each step were subjected into SDS-PAGE analysis and coomassie blue staining (Figure 13).
▲ Figure 13: The coomassie blue staining of SDS-PAGE showed the CBD-grGFP protein purified by nickel-agarose beads.
Part C: Producing the antimicrobial proteins, CBD-D2A21, CBD-DPK-060 and CBD-TAT-DPK-060
Major experiments:
1. Cloning CBD-D2A21, CBD-DPK-060 and CBD-TAT-DPK-060 into pRSET vector
2. Expressing protein
3. Cloning CBD-D2A21, CBD-DPK-060 and CBD-TAT-DPK-060 into pET32a vector
4. Expressing protein
Achievement:
All constructs in this part are finished and subjected to protein expression.
Cloning CBD-D2A21, CBD-DPK-060 and CBD-TAT-DPK-060 into pRSET vector
We ordered the biobrick set of CBD-D2A21, CBD-DPK-060 and CBD-TAT-DPK-060 from IDT company. To express these proteins, we excised the CBD-D2A21, CBD-DPK-060 and CBD-TAT-DPK-060 with restriction enzymes BamHI and HindIII from vectors provided by IDT and ligated into pRSET vector. The colony PCR using a primer pair recognizing the CBD sequence and T7 terminator showed the expected size (Figure 1 and 2). Therefore, we subjected these pRSET-CBD-D2A21, pRSET-CBD-DPK-060, and pRSET-CBD-TAT-DPK-060 into protein expression.
▲ Figure 1: The colony PCR result of CBD-DPK-060 and CBD-D2A21 cloning. The primer pair used for PCR examination is CBD-485F and T7-terminator. The expected amplicon size is ~300 bp in length.
▲ Figure 2: The colony PCR result of CBD-TAT-DPK-060 cloning. The primer pair used for PCR examination is CBD-485F and T7-terminator. The expected amplicon size is ~400 bp in length.
The sequence of primer pair used for colony PCR is listed below:
CBD-485F: ACGAGGAAATCTGCACAACC
T7t: GCTAGTTATTGCTCAGCGG
Expressing protein
We then transformed the confirmed pRSET vectors into E. coli BL21 and induced protein expression by incubating bacteria in TB medium containing 1 mM IPTG at 37 ℃ for 8 hr. The expected size of CBD-D2A21 and CBD-DPK-060 protein is around 30.6 kDa. However, we could not find induced protein at corresponding size in PAGE analysis and coomassie blue staining (Figure 3 and 4).
▲ Figure 3: The coomassie blue staining of SDS-PAGE gel showed the CBD-D2A21 protein expression at indicated condition.
▲ Figure 4: The coomassie blue staining of SDS-PAGE gel showed the CBD-DPK-060 protein expression at indicated condition.
We then re-examined whether the pRSET constructs contain the right CBD-AMPs inserts by Sanger sequencing. The result showed that all pRSET constructs contain the right sequence and the open reading frame is correct (Figure 5). Therefore, we decided to shift the expression vector to pET32a.
▲ Figure 5: The electrogram result of pRSET-CBD-DPK-060.
Cloning CBD-D2A21 and CBD-DPK-060 into pET32a vectors.
Unfortunately, because of the pandemic outbreak, we must hold experiments and wait for the lab re-opening.
On the other hand, the expected size of CBD-TAT-DPK-060 protein is 32.5 kDa. The PAGE analysis and coomassie blue staining shows that the protein expression at 32.5 kDa is strong in either control or induced bacteria (Figure 6).
▲ Figure 6: The coomassie blue staining of SDS-PAGE gel showed the CBD-TAT-DPK-060 protein expression at indicated condition.
To further confirm the protein with the predicted molecular weight is CBD-TAT-DPK-060, we performed the time course examination, and harvested IPTG induced cells every hour. The harvested cells were then disrupted to examine the location of induced protein. The PAGE analysis and coomassie blue staining suggested that the 32.5 kDa protein was all in the inclusion body (Figure 7).
▲ Figure 7: The coomassie blue staining of SDS-PAGE showed the CBD-TAT-DPK-060 protein expression at indicated condition. P: pellet; S: supernatant.
To further confirm whether the CBD-TAT-DPK-060 protein is induced by IPTG treatment, we performed immuno blotting analysis with anti-His tag antibodies. The result indicated that the 32.5 kDa protein was weakly recognized by anti-His tag antibodies, suggesting that the 32.5 kDa protein may be CBD-TAT-DPK-060 (Figure 8).
▲ Figure 8: The immuno blot analysis of CBD-TAT-DPK-060 induction with His-tag antibody at indicated condition. P: pellet; S: supernatant.
Therefore, we subjected the IPTG-induced bacteria into nickel-agarose beads purification. The supernatant from induced cells was incubated with nickel-agarose beads, and the unbound protein was extensively washed out by PBS. The elution was performed by 150 mM Imidazole in PBS. All samples of each step were subjected into SDS-PAGE analysis and coomassie blue staining (Figure 9). The result showed that CBD-TAT-DPK-060 can be captured by nickel agarose beads.
▲ Figure 9: The coomassie blue staining of SDS-PAGE showed the CBD-TAT-DPK-060 protein purified by incubating with nickel-agarose beads. S: supernatant; F: flow-through.
We then performed FPLC to purify the CBD-TAT-DPK-060 protein. The supernatant from induced cells was incubated with the nickel column and unbound protein was first washed out (the fractions 1-6 in Figure 10). We then increased the Imidazole concentration (the green line in Figure 10A) to elute bound proteins. The PAGE analysis and coomassie blue staining suggested that the CBD-TAT-DPK-060 protein was eluted at fractions 10-17 (Figure 10). However, CBD-TAT-DPK-060 was not the major protein in the eluted fraction. Therefore, we decided to shift the CBD-TAT-DPK-060 expression vector to pET32a.
▲ Figure 10: The FPLC purification and SDS-PAGE examination of CBD-TAT-DPK-060 expression. (A) The UV absorbance at different time points during imidazole elution. (B) The SDS-PAGE and coomassie blue staining of fractions collected during imidazole elution.
Part D (Improvement): Confirming that TAT48-57 peptide is thrombin releasable
Major experiments:
1. Constructing CBD-TAT48-57-eGFP and CBD-TAT47-57-eGFP
2. Expressing CBD-TAT48-57-eGFP and CBD-TAT47-57-eGFP proteins
3. Performing the thrombin cleavage test (hold because of the pandemic)
Achievement:
All constructs in this part are finished and subjected to protein expression.
Constructing CBD-TAT48-57-eGFP and CBD-TAT47-57-eGFP
To construct the vector expressing CBD-TAT48-57-eGFP and CBD-TAT47-57-eGFP, we design primers containing EcoRI cloning site and TAT48-57 or TAT47-57 sequence at 5’ terminal, which target eGFP open reading frame to add TAT48-57 or TAT47-57 sequence on to eGFP.
The primer sequence are listed below:
EcoRI-TAT48-GFP-F: CATATGGGCCGAAAAAAACGCCGTCAGCGGCGCCGTGGATCCGTGAGCAAGGGC
EcoRI-TAT47-GFP-F: CATATGTACGGCCGAAAAAAACGCCGTCAGCGGCGCCGTGGATCCGTGAGCAAGGGC
HindIII-eGFP-R: AAGCTTTTACTTGTACAGCTCGTCCAT
We then perform PCR to amplify the target fragment. The result showed that the amplicon sizes of TAT48-57-eGFP (780 bp) and TAT47-57-eGFP (783 bp) are as expected (Figure 1).
▲ Figure 1: The agarose image shows the PCR result of TAT isoform amplification.
The amplicons of TAT48-57 and TAT47-57 were then ligated into TA clones. After sequencing confirmation, we excised the TAT48-57-eGFP and TAT47-57-eGFP fragments from TA vectors with BamHI and HindIII digestion (Figure 2). The excised fragments were then extracted from agarose gel and ligated with CBD into a pET32a vector.
▲ Figure 2: The agarose image shows the excision of TAT48-57-eGFP and TAT47-57-eGFP fragments from TA vectors with BamHI and HindIII digestion.
We then transformed the ligation product into E. coli DH5a and performed colony PCR using primer pair CBD-F and T7 terminator. The amplicon size ~1040 bp is as expected (Figure 3).
▲ Figure 3: The agarose image shows the colony PCR result of ligation of CBD-TAT48-57-eGFP and CBD-TAT47-57-eGFP with pET32a.
To express the CBD-TAT48-57-eGFP and CBD-TAT47-57-eGFP proteins, we transformed the pET32a-CBD-TAT48-57-eGFP and pET32a-CBD-TAT47-57-eGFP in to E. coli BL21. The protein expression was induced by culturing bacteria in TB medium containing 1 mM IPTG at 37°C for 8 hr. The SDS-PAGE and comaciess blue staining result showed that the CBD-TAT48-57-eGFP (70.7 kDa) and CBD-TAT47-57-eGFP (70.8 kDa) proteins were induced (Figure 4).
▲ Figure 4: The coomassie blue staining showed the induction of CBD-GFP proteins.
To optimize the protein expression, we performed the cell disruption. The protein expression was induced by culturing bacteria in TB with 1 mM IPTG at 37 °C. The bacterial samples were collected every 2 hrs. All collected samples were subjected into SDS-PAGE analysis and coomassie blue staining (Figure 5). The result showed a weak CBD-TAT48-57-eGFP protein expression. We will do a small batch of protein purification by nickel agarose beads.
▲ Figure 5: The coomassie blue staining of SDS-PAGE showed the CBD-TAT48-57-eGFP and CBD-TAT47-57-eGFP protein expression in soluble or insoluble fraction at the indicated conditions.
Part E: The antimicrobial activity of AMPs
Major experiments:
the minimal inhibitory concentration (MIC) analysis of DPK-060 and D2A21
Achievement:
We determined that the MIC of DPK-060 and D2A21 against E. coli is respectively 7.752 µM and 2.972 µM, while these against S. aureus is respectively 9.304 µM and 6.759 µM.
To examine minimal inhibitory concentration (MIC) of D2A21 and DPK-060, we first prepared 200 μM D2A21 and 100 μM DPK-060 stock with Mueller Hinton Broth (MHB). The stock was then serially diluted and incubated with 105 bacteria overnight. The survival of bacteria was determined by the absorbance at 625 nm.
In the MIC analysis using E. coli, we found that the MIC of DPK-060 and D2A21 is 7.752 µM and 2.972 µM (Figure 1 and Table 1). In the MIC analysis using S. aureus, we found that the MIC of DPK-060 and D2A21 is 9.304 µM and 6.759 µM. (Figure 2 and Table 1).
▲ Figure 1: The modified Gompertz curve of E. coli in D2A21.
▲ Figure 2: The modified Gompertz curve of S. aureus in D2A21.
▲ Table 1: The MIC of D2A21 and DPK-060 against E. coli and S. aureus. MIC90 is defined as the minimal concentration required to inhibit the growth of 90% of microorganisms.
This result suggested that DPK-060 and D2A21 have antimicrobial activity. However, the MIC values we test are approximately twice the MIC from the reference [1][2]. This conflict may be caused by the solvent of AMPs. Because the change of solvent from MHB to RPMI-1640 significantly affected the MICs (Table 2). Nevertheless, more carefully designed experiments are necessary to address this issue.
▲ Table 2: The MIC of DPK-060 in different solvent. DPK-060 in RPMI-1640 has stronger antimicrobial activity than DPK-060 in MHB.
References：
1. Schwab, U., Gilligan, P., Jaynes, J., & Henke, D. (1999). In vitro activities of designed antimicrobial peptides against multidrug-resistant cystic fibrosis pathogens. Antimicrobial agents and chemotherapy, 43(6), 1435–1440.
2. Boge, L., Umerska, A., Matougui, N., Bysell, H., Ringstad, L., Davoudi, M., Eriksson, J., Edwards, K., & Andersson, M. (2017). Cubosomes post-loaded with antimicrobial peptides: characterization, bactericidal effect and proteolytic stability. International journal of pharmaceutics, 526(1-2), 400–412.
Part F: The biosafety of AMPs and TAT
Major experiments:
1. The cytotoxicity assay
2. The hemolysis assay
Achievement:
The cytotoxicity and hemolysis is extremely low in DPK-060, suggesting that DPK-060 may be a much safer candidate for clinical application.
Cytotoxicity
The cytotoxicity assay is designed to test cell viability under different concentrations of AMPs to examine minimal AMP concentration without harming human cells. Following the International Standard ISO 10993-5, a reduction of cell viability by more than 30% is considered cytotoxic.
First, we survey the reported MIC of DPK-060 and D2A21 in reference, showing that the MIC of D2A21 against S. aureus is 0.09 μM to 1.44 μM, while the MIC of DPK-060 against S. aureus is 1.6 μM (Table 1). We then set cytotoxicity assay to examine whether the excess AMPs (>10 times) harm human cells.
▲ Table 1: The MIC of D2A21 and DPK-060
For D2A21 concentration applied in cytotoxicity assay, we start from 0.9 μM to 28.8 μM, which is around 20 times to the reported MIC of D2A21. The indicated concentration of AMPs were incubated with differentiated U937 cells for 72 hours, and the cell viability is demonstrated by MTS assay. The result showed that D2A21 would not harm differentiated U937 cells below 3.6 μM (Figure 1).
▲ Figure 1: The MTS analysis showed the cell viability after incubating with D2A21 at indicated concentration for 72 hours. The cell viability was all normalized to mock control.
For DPK-060 concentration applied in cytotoxicity assay, we start from 1.99 μM to 63.8 μM, which is 40 times to the reported MIC of DPK-060. The indicated concentration of AMPs were incubated with differentiated U937 cells for 72 hours, and the cell viability is demonstrated by MTS assay. The result showed that DPK-060 would not harm human cells even at the highest concentration (Figure 2).
▲ Figure 2: The MTS analysis showed the cell viability after incubating with DPK-060 at indicated concentration for 72 hours. The cell viability was all normalized to mock control.
For TAT concentration applied in cytotoxicity assay, we can not find the MIC reference of TAT. Because we linked TAT with DPK-060, we set the TAT concentration from 1.5 μM to 50 μM, which is close to the range of DPK-060. The indicated concentration of TAT was incubated with differentiated U937 cells for 72 hours, and the cell viability is demonstrated by MTS assay (Figure 3). The result showed that DPK-060 would not harm human cells even at the highest concentration.
▲ Figure 3: The MTS analysis showed the cell viability after incubating with TAT at indicated concentration for 72 hours. The cell viability was all normalized to mock control.
Hemolysis analysis
The hemolysis is applied to examine whether DPK-060 and D2A21 will induce hemolysis under different concentrations. According to the International Standard ISO 10993-4, hemolysis lower than 2% is considered as a safety requirement.
For D2A21 concentration applied in hemolysis assay, we start from 1.8 μM to 28.8 μM, which is around 40 times to the reported MIC of D2A21. The indicated concentration of D2A21 was incubated with 0.5 % mouse RBCs suspension for one hour, and the lysed RBCs were recorded by OD 414 nm. The result showed that D2A21 would not induce hemolysis below 3.6 μM (Figure 4).
▲ Figure 4: The bar chart shows the percentage hemolysis of RBC incubated with D2A21 at indicated concentrations.
For DPK-060 concentration applied in hemolysis assay, we start from 3.9875 μM to 63.8 μM, which is around 40 times to the reported MIC of DPK-060. The indicated concentration of DPK-060 was incubated with 0.5 % mouse RBCs suspension for one hour, and the lysed RBCs were recorded by OD 414 nm. The result showed that DPK-060 would not induce hemolysis even at 63.8 μM (Figure 5).
▲ Figure 5: The bar chart shows the percentage hemolysis of RBC incubated with DPK-060 at indicated concentrations.
For TAT concentration applied in hemolysis assay, we can not find the MIC reference of TAT. Because we linked TAT with DPK-060, we set the TAT concentration from 3.125 μM to 50 μM, which is close to the range of DPK-060. The indicated concentration of TAT was incubated with 0.5 % mouse RBCs suspension for one hour, and the lysed RBCs were recorded by OD 414 nm. The result showed that TAT would not induce hemolysis even at 50 μM (Figure 6).
▲ Figure 6: The bar chart shows the percentage hemolysis of RBC incubated with TAT at indicated concentrations.
References：
1. Hao, G., Zhang, S., & Stover, E. (2017). Transgenic expression of antimicrobial peptide D2A21 confers resistance to diseases incited by Pseudomonas syringae pv. tabaci and Xanthomonas citri, but not Candidatus Liberibacter asiaticus. PloS one, 12(10), e0186810.
2. Boge, L., Umerska, A., Matougui, N., Bysell, H., Ringstad, L., Davoudi, M., Eriksson, J., Edwards, K., & Andersson, M. (2017). Cubosomes post-loaded with antimicrobial peptides: characterization, bactericidal effect and proteolytic stability. International journal of pharmaceutics, 526(1-2), 400–412.
Part G: The Integrity and Swelling test of chitosan-alginate (CA) sponge
Background:
The function of the absorptive layer in our dressing AgenT is to absorb wound exudate. This layer is a composite material formed by ionic crosslinking between alginate and chitosan, named as chitosan-alginate (CA) sponge. For more detail of preparation, click protocol. As an absorptive layer, the CA-sponge should fullfit two basic characteristics, the high integrity, and good absorbability. Therefore, we first conduct a photo image analysis to examine the integrity of CA-sponge formed by different ratios of alginate and chitosan.
Integrity analysis:
Under the photo image analysis, the cracks in CA-sponge will be shown as black areas. Therefore, we defined the integrity of CA-sponges as the percentage of white area to all areas, and we set the threshold that the good integrity of CA-sponges should be higher than 95%.
Next, we conduct a swelling test to figure out the absorbability of CA-sponge formed by different ratios of alginate and chitosan.
Swelling test:
The CA-sponges are weighted before and after incubating in pH 7.4 PBS saline for 1 hour at room temperature, and the absorbability is defined as weight after incubation divided by weight before incubation.
Experimental result:
1. Mix alginate and chitosan with different ratios:
To examine whether the mixing ratio of alginate and chitosan affects integrity and absorbability, we generated CA-sponges by mixing 1% alginate and 1% chitosan solution with the ratio from 4:1, 3:1, 2:1, 1:1, to 1:2, 1:3, and 1:4. The image of the formed CA-sponge was taken and analyzed for integrity. The result showed that only the integrity of CA-sponge with mixing ratio 3:1 (alginate : chitosan) is slightly lower than 95%. All other CA-sponges formed by other mixing ratios showed high integrity (>95%), suggesting that the mixing ratio of alginate and chitosan did not significantly affect the integrity (Figure 1).
▲ Figure 1: The photo images of CA-sponges formed by mixing different ratios of 1% alginate and 1% chitosan. The images of CA-sponges were taken by fixed distance, angle, and light resource. The mixing ratios of 1% alginate to 1% chitosan in each CA-sponge are (A) 4:1, (B) 3:1, (C) 2:1, (D)1:1, (E)1:2, (F)1:3, and (G)1:4. The image quantification results of integrity are shown in each figure.
We then performed the swelling test, showing that the CA-sponge formed by different mixing ratios of alginate and chitosan can absorb PBS from three times to 19 times, as compared to the weight before absorption (Table 1). We observed a trend that the higher the ratio of alginate in CA-sponge, the lower the absorbability, as indicated in the column (A)~(D) in Table 1. On the other hand, the reverse trend is also observed that the higher the ratio of chitosan in CA-sponge, the higher the swelling rate of CA-sponge, as indicated in the column (D)~(G) in Table 1. The best absorbability of CA-sponge is around 19 times at the mixing ratio 1:3 (alginate : chitosan).
▲ Table 1: The absorbability of CA-sponges formed by mixing different ratios of 1% alginate and 1% chitosan.
To sum up, mixing one part of 1% chitosan with three parts of 1% alginate solutions showed the best integrity and absorbability, and we will apply the CA-sponge formed by mixing one part of 1% chitosan with three parts of 1% alginate solutions to carry out the dressing combination.
Part H: Dressing combination
Overview:
AgenT Dressing consists of three different layers. The outer layer is polyurethane film. The middle layer is the absorptive CA-sponge composed of chitosan and alginate. The inner layer is the collagen layer. To confirm the combination of CA-sponge and collagen would not affect the absorptibility, we performed the swelling test on CA-sponge with collagen coating.
Achievement:
Compared to CA-sponges composed only of alginate and chitosan, the absorbability of collagen-coated CA-sponges decreases from 19 times to 8 times.
Experimental result of CA-sponge with coating collagen:
To examine whether the collagen coating affects the absorbability of the entire dressing, we generated CA-sponges by mixing 1% alginate and 1% chitosan solution with the ratio of 3:1 (see the result of PART F) and add 0.4 mL collagen 3D-gel solutionon the CA-sponge. After air-drying for four hours at 37℃, we then performed the swelling test, showing that the absorbability of the CA-sponge with coating collagen is from 7.28 times to 9.96 times (Table 1).
▲ Table 1: The absorbability of CA-sponges with collagen coating.
Compared to CA-sponges composed only of alginate and chitosan, the absorbability of collagen-coated CA-sponges decreases from 19 times to 8 times (Table 2 and Figure 1).
▲ Table 2: Compared to the absorbability of CA-sponge before and after coating collagen.
▲ Figure 1: Compared to the absorbability of CA-sponge before and after coating collagen.
We supposed that the collagen solution may remain in some of the pores of the CA-sponge microporous structure and reduce the water absorption capacity of the entire dressing.
Combination result:
Because the polyurethane film is sticky, we can directly stick the collagen-coated CA-sponge on to it. Figure 2 shows the picture of the AgenT dressing combination.
▲ Figure 2: The combination of AgenT dressing.
To sum up, AgenT Dressing is user-friendly due to the self-adhesive characteristics of PU film. The patients could stick it on wounds straightforwardly without special training required. Also, AgenT dressing has a certain extent of absorbability after coating with collagen. It can provide a suitable healing environment by absorbing excessive exudate secreted from wounds. In the future, we will conduct the CBD affinity of our antimicrobial agents to confirm the connection between dressing and the protein we designed.
Part I: Thrombin cleavage assay
Overview:
The antimicrobial activity of AgenT Dressing is achieved by releasing antibacterial agents into the wound after contacting with thrombin in the blood. The thrombin cleave thrombin sites and left two residues, the P1’ and P2’ sites on the product. There, the direct application of thrombin sites in front AMPs or TAT-AMP have activity concerns of AMPs or TAT-AMPs. To tickle this question, we modify the conventional thrombin sites to fit AMPs or TAT-AMP. However, the release rate of different thrombin cleavage sites are not determined in detail [1]. To this end, we performed the thrombin cleavage assay to examine whether the release rate of modified thrombin cleavage sites (Figure 1). The modified thrombin cleavage sites are GR (TAT48-57), GK (DPK060), FA (D2A21), YG (TAT47-57), and GR (TAT48-57). To easily observe the release of AMPs or TAT-AMPs, we substituted AMPs with eGFP.
▲ Figure 1: Five different biobricks of synthetic proteins containing the modified thrombin cleavage sites in the linker between CBD and eGFP.
In thrombin cleavage assay, the generated CBD-eGFPs protein was pre-bound on nickel agarose beads. The CBD-eGFPs protein bound beads were then incubated with 0.04 U thrombin, which is equal to 0.6μM, for 16 hours at room temperature [2]. The thrombin cleaved eGFP will be released in supernatant. Therefore, we harvested 10μl supernatant every 30 minutes. The amount of eGFP is measured by SDS-PAGE.
Unfortunately, the COVID-19 pandemic has come back to Taiwan, which makes the CBD-eGFP protein not available on time. Hence, we conduct the thrombin cleavage assay by using protein containing 6xHis-thrombin site (LVPRGS)-eGFP (purified in Part A) as the substrates.
SDS-PAGE analysis of cleavage and expression
First, we pre-bound the 6xHis-thrombin site-eGFP proteins on the nickel-agarose beads, and the unbound protein was washed out by PBS. The 6xHis-thrombin site-eGFP bound on nickel-agarose were applied in thrombin cleavage assay. The bound beads were then incubated with 0.04 U thrombin, which is equal to 0.6μM, for 16hour at room temperature. The thrombin cleaved eGFP will be released in supernatant. Therefore, we harvested 10μl supernatant every 30 minutes. The amount of eGFP is measured by SDS-PAGE and coomassie staining. The result showed that the eGFP protein was shown in supernatant in the first 30 mins, and the amount increased with treatment time . The amount of eGFP protein was statured at 6hrs (Figure 2).
▲ Figure 2: The coomassie blue staining of SDS-PAGE showed the released eGFP protein in supernatant after thrombin cleavage.
Next, to analyze these gel consistently and quantitatively, we utilized the MATLAB scriptsto normalize and calculate the integrated signal from each band. Figure 3 shows that the time-dependent intensity (black dots) increases with the reaction time. Moreover, we determine the order of thrombin cleavage rate for eGFP protein via data fitting. We fit the integrated intensity from gel using first- and second-order rate law. The curve in Figure 3 indicates that the thrombin cleavage tends to behave like a first-order reaction with a rate constant of 0.4393 hr-1.
In the future, we are establishing the cleavage assay to speculate the release rate of our antimicrobial agents with different cleavage sites and set the effective time of antimicrobial activity of our product.
▲ Figure 3: The dot plot shows the relation between cleaved eGFP concentration (black dots) and the release time. The first-order rate law ([S] = [S0]e(-kt)) was applied to fit the data and revealed that the rate constant (k) is 0.4393 hr-1, while R2 is 0.8842.
References：
1. Gallwitz, M., Enoksson, M., Thorpe, M., & Hellman, L. (2012). The extended cleavage specificity of human thrombin. PloS one, 7(2), e31756.
2. Mann, K. G., Brummel, K., & Butenas, S. (2003). What is all that thrombin for?. Journal of thrombosis and haemostasis : JTH, 1(7), 1504–1514.
