Line 1: | Line 1: | ||
− | |||
<!--{{IGEM_TopBar}}--> | <!--{{IGEM_TopBar}}--> | ||
{{IISER-Tirupati India}} | {{IISER-Tirupati India}} | ||
Line 10: | Line 9: | ||
− | <div class="wrapper"> | + | <div class="wrapper" style="background-color: #FDF8D7;"> |
<header> | <header> | ||
<section class="container-fluid" style="background-color: #8D1063;"> | <section class="container-fluid" style="background-color: #8D1063;"> | ||
− | <img class="img img-fluid" src="https://static.igem.org/mediawiki/2021/ | + | <img class="img img-fluid" src="https://static.igem.org/mediawiki/2021/7/7c/T--IISER-Tirupati_India--PROOF_OF_CONCEPT-01.svg" style="width: 100%;"> |
− | <div class=" row justify-content-center | + | <div class=" row justify-content-center d-none d-lg-flex" style="width: 100% !important;"> |
− | + | <div class="down-arrow" style="color: hsl(320, 80%, 31%);"><strong>SCROLL</strong> | |
− | + | <svg width="16" height="16" fill="#8D1063" class="bi bi-chevron-double-down" viewBox="0 0 16 16"> | |
− | + | <path fill-rule="evenodd" d="M1.646 6.646a.5.5 0 0 1 .708 0L8 12.293l5.646-5.647a.5.5 0 0 1 .708.708l-6 6a.5.5 0 0 1-.708 0l-6-6a.5.5 0 0 1 0-.708z"/> | |
− | + | <path fill-rule="evenodd" d="M1.646 2.646a.5.5 0 0 1 .708 0L8 8.293l5.646-5.647a.5.5 0 0 1 .708.708l-6 6a.5.5 0 0 1-.708 0l-6-6a.5.5 0 0 1 0-.708z"/> | |
+ | </svg> | ||
+ | </div> | ||
</div> | </div> | ||
</section> | </section> | ||
Line 44: | Line 45: | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Description">DESCRIPTION</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Description">DESCRIPTION</a></li> | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Blueprint">BLUEPRINT</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Blueprint">BLUEPRINT</a></li> | ||
− | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Engineering">ENGINEERING SUCCESS</a></li> | + | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Engineering">ENGINEERING SUCCESS </a></li> |
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Background">BACKGROUND</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Background">BACKGROUND</a></li> | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Implementation">IMPLEMENTATION</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Implementation">IMPLEMENTATION</a></li> | ||
Line 55: | Line 56: | ||
</a> | </a> | ||
<ul class="dropdown-menu fade-down" aria-labelledby="navbarDropdown"> | <ul class="dropdown-menu fade-down" aria-labelledby="navbarDropdown"> | ||
− | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/ | + | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Proof_Of_Concept">PROOF OF CONCEPT </a></li> |
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Design">DESIGN</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Design">DESIGN</a></li> | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Parts">PARTS</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Parts">PARTS</a></li> | ||
Line 82: | Line 83: | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Communication">COMMUNICATION</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Communication">COMMUNICATION</a></li> | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Inclusivity">INCLUSIVITY</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Inclusivity">INCLUSIVITY</a></li> | ||
− | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Sustainable">SUSTAINABLE DEVELOPMENT</a></li> | + | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Sustainable">SUSTAINABLE DEVELOPMENT </a></li> |
</ul> | </ul> | ||
</li> | </li> | ||
Line 89: | Line 90: | ||
TEAM | TEAM | ||
</a> | </a> | ||
− | <ul class="dropdown-menu fade-down" aria-labelledby="navbarDropdown"> | + | <ul class="dropdown-menu dropdown-menu-end fade-down" aria-labelledby="navbarDropdown"> |
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Team">MEMBERS</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Team">MEMBERS</a></li> | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Attributions">ATTRIBUTION</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Attributions">ATTRIBUTION</a></li> | ||
− | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Collaborations">COLLABORATIONS</a></li> | + | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Collaborations">COLLABORATIONS </a></li> |
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Partnership">PARTNERSHIP</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Partnership">PARTNERSHIP</a></li> | ||
</ul> | </ul> | ||
Line 100: | Line 101: | ||
</div> | </div> | ||
</nav> | </nav> | ||
+ | |||
<main> | <main> | ||
− | <div class="container"> | + | <div class="container-fluid"> |
− | <div class="row | + | <div class="row"> |
− | <div class="col-md- | + | |
− | < | + | <div class="col-md-4 col-lg-3 p-2 d-none d-md-block" style="background-color: #FFBD59 !important; color: #8D1063;"> |
− | + | <div class="card" style=" max-width: 15.5rem; border: none !important;background-color:#FFBD59;" id="index"> | |
− | + | <div class="card-body"> | |
− | + | <h3 class="card-title text-center mb-3">INDEX</h3> | |
− | + | <section id="Index1"> | |
− | + | <h5><a class="index_link" href="#index2" style="color: #8D1063 !important;">Results of Basic Experiments</a></h5> | |
− | + | <ul> | |
− | + | <li><a class="index_link" href="#1">Growth curves</a></li> | |
− | + | <li><a class="index_link" href="#2">Preparation of competent cells and transformation </a></li> | |
− | + | <li><a class="index_link" href="#3">Protein Purification</a></li> | |
− | + | <li><a class="index_link" href="#4">Cloning</a></li> | |
− | + | <li><a class="index_link" href="#5">Summary</a></li> | |
− | + | </ul> | |
− | + | </section> | |
− | + | </div> | |
− | + | </div> | |
− | + | </div> | |
− | + | ||
− | + | <div class="col-12 col-md-8 px-5 py-3"> | |
− | + | <p>The wet lab team of Team IISER-Tirupati_India arrived on campus in the last week of July and saw their undergraduate Biology lab after 1.5 years, which felt like ages had passed. </p> | |
− | + | <p>We were determined and hopeful to produce results for our Proof of Concept. With ample preparation of protocols, ordering all consumables, discussions with seniors and advice from our PIs, we thought we were set for all kinds of experiments. </p> | |
− | + | <p>However, with the COVID-19 pandemic at large, we had very limited hours of access to the lab and we began with laboratory safety training conducted by our technical assistants. Then we started our wet lab journey acclimatizing with all laboratory techniques and instruments first. The pandemic delayed the process of acquiring resources including reagents and DNA from our kind sponsors IDT and Twist Bioscience which was a major roadblock for us. We received our DNA in mid-September and picked up the pace, only to realise that 2 months of lab access might not be enough to complete all our experiments.</p> | |
− | + | <p>Nevertheless, we are proud that the wet lab members have worked day-in and day-out to work towards making an attempt towards successful producing results and gaining knowledge and experience of research in synthetic biology.</p> | |
− | + | <p id="index2">We had a bunch of successful experiments, but a pile of failed ones as well. This page talks about our journey of those 2 months in the laboratory and the amount of background work put together by the entire team to try and actualise OviCloak.</p> | |
− | + | <h2 id="1">Results of Basic Experiments</h2> | |
− | + | <p>Our team performed some preliminary experiments in the first few weeks.</p> | |
− | + | <h3>Growth curves</h3> | |
− | + | <h4><em>Escherichia coli</em> DH5-alpha</h4> | |
− | + | <figure class="col-12 col-md-8 my-3 m-auto"> | |
− | < | + | <img src="https://static.igem.org/mediawiki/2021/f/ff/T--IISER-Tirupati_India--E_coli_growth_curve.png" alt="Trulli" style="width:100%"> |
− | + | <figcaption class="text-center">Fig 1. Growth curve of Escherichia coli DH5α - 1</figcaption> | |
− | + | </figure> | |
− | + | <figure class="col-12 col-md-8 my-3 m-auto"> | |
− | + | <img src="https://static.igem.org/mediawiki/2021/9/9b/T--IISER-Tirupati_India--E_coli_growth_curve2.png" alt="Trulli" style="width:100%"> | |
− | + | <figcaption class="text-center">Fig 2. Growth curve of Escherichia coli DH5α - 2</figcaption> | |
− | + | </figure> | |
− | + | <figure class="col-12 col-md-8 my-3 m-auto"> | |
− | <p> | + | <img src="https://static.igem.org/mediawiki/2021/1/15/T--IISER-Tirupati_India--E_coli_growth_curve_comparison.png" alt="Trulli" style="width:100%"> |
− | + | <figcaption class="text-center">Fig 3. Comparison of Escherichia coli DH5α growth curves</figcaption> | |
− | + | </figure> | |
− | + | <p>The growth curves had unusual data points for the OD at 600 when observed at different time points. However, we could observe a trend in the curve and we could use this as a reference for our future experiments.</p> | |
− | + | <p>We do realise that this is not the ideal or the best curve.</p> | |
− | + | ||
− | + | <h4><em><em>Bacillus subtilis 168 </em></em></h4> | |
− | + | ||
− | + | <figure class="col-12 col-md-8 my-3 m-auto"> | |
− | + | <img src="https://static.igem.org/mediawiki/2021/b/be/T--IISER-Tirupati_India--B_subtilis_growth_curve.png" alt="Trulli" style="width:100%"> | |
− | + | <figcaption class="text-center">Fig 4. Growth curve of Bacillus subtilis 168</figcaption> | |
− | + | </figure> | |
− | + | <p>This was one of the first experiments that we performed and the results turned out to be quite close to the expected results, not the best though.</p> | |
− | + | <p>We could infer that <em>Bacillus subtilis 168</em> enters the stationary phase between 6-7 hours after inoculation.</p> | |
− | + | <p>This was crucial information that we utilised for our experiment of the Transformation of <em>B. subtilis 168 </em>with our plasmid of interest. </p> | |
− | + | <h4><em><em>Saccharomyces cerevisiae S288C</em></em></h4> | |
− | + | <figure class="col-12 col-md-8 my-3 m-auto"> | |
− | + | <img src="https://static.igem.org/mediawiki/2021/d/d3/T--IISER-Tirupati_India--Yeast_growth_curve_1.png" alt="Trulli" style="width:100%"> | |
− | < | + | <figcaption class="text-center">Fig 5. Growth curve of Saccharomyces cerevisiae S288C -1</figcaption> |
− | + | </figure> | |
− | + | <figure class="col-12 col-md-8 my-3 m-auto"> | |
− | + | <img src="https://static.igem.org/mediawiki/2021/8/86/T--IISER-Tirupati_India--Yeast_growth_curve_2.png" alt="Trulli" style="width:100%"> | |
− | + | <figcaption class="text-center">Fig 6. Growth curve of Saccharomyces cerevisiae S288C -2</figcaption> | |
− | + | </figure> | |
− | < | + | <figure class="col-12 col-md-8 my-3 m-auto"> |
− | + | <img src="https://static.igem.org/mediawiki/2021/1/1b/T--IISER-Tirupati_India--Yeast_growth_curve_comparison.png" alt="Trulli" style="width:100%"> | |
− | + | <figcaption class="text-center">Fig 7. Comparison of Saccharomyces cerevisiae S288C curves</figcaption> | |
− | + | </figure> | |
− | + | <p>These 24-hours growth curves of <em>Saccharomyces cerevisiae </em>S288C<em>, </em>(with some abrupt data points) show a similar trend. </p> | |
− | + | <p>Important pointers:</p> | |
− | + | <ol> | |
− | + | <li>Growth curves need to be standardized by all labs, even if 2 labs share the same strain of the organism</li> | |
− | + | <li>Growth curves are an easy and effective way to study the nature and behaviour of an organism in a particular given environment.</li> | |
− | + | <li>All the above growth curves were observed in nutrient-rich media (LB for bacterial strains and YPD for <em>S.cerevisiae</em>)</li> | |
− | + | </ol> | |
− | + | <h3>Plasmid Isolation</h3> | |
− | + | <p>With the E.coli clones that Dr SK Gupta from National Institute of Immunology, India for ZP2 cloned in pRSETB, Dr Sabari from IISER Thiruvananthapuram for pDR111 and pDR110 vectors and the ones that Dr Vijayalakshmi from IISER Tirupati for pRS426,<span id="2"></span> our team began to isolate these plasmids for our future cloning experiments.</p> | |
− | + | <p>After several optimisations in our protocol, we could efficiently isolate plasmids. Our average concentration of DNA started to be around 100-150 ng/ul and our most efficient concentration was 6969 ng/ul</p> | |
− | + | <h2>Preparation of competent cells and transformation </h2> | |
− | + | ||
− | + | <h3><em>Escherichia coli</em><em>DH5-alpha</em> and <em>Escherichia coli</em><em>BL21</em></h3> | |
− | + | ||
− | + | <p>Our team was extremely excited to get competent <em>E.coli DH5-alpha</em> and <em>E.coli BL21 </em>cells in our FIRST attempt.<br />We’re thankful to the VD lab for helping us with the chemical competency protocol. We verified the DH5-alpha competency of the cells, by transforming empty backbone pDR111 isolated earlier and likewise for BL21, we transformed pRSETB containing ZP2 protein to verify their competency.</p> | |
− | + | <figure class="col-12 col-md-8 my-3 m-auto"> | |
− | < | + | <img src="https://static.igem.org/mediawiki/2021/5/5c/T--IISER-Tirupati_India--Escherichia_coli_DH5%CE%B1_Transformants_-_pRSETB_with_ZP2_gene.png" alt="Trulli" style="width:100%"> |
− | + | </figure> | |
− | + | <figcaption class="text-center">Fig 8. Escherichia coli DH5α Transformants - pRSETB with ZP2 gene | |
− | + | Image 1 and 2: Transformants on LB agar plate with Ampicillin | |
− | + | Image 3: a. Top left corner: Control (without DNA) on LB agar plate with Ampicillin ; b. Other 3 plates: Transformants on LB agar plate with Ampicillin </figcaption> | |
− | + | ||
− | + | <h3 class="mt-3"><em>Bacillus subtilis</em> 168 </h3> | |
− | + | ||
− | + | <p>With the <em>B.subtilis</em> strain and protocols provided by Dr Sabari, we were able to successfully transform pDR111 empty backbone, pDR111 containing genes of interest and confirm genome integration of the antibiotic-resistant gene.</p> | |
− | + | <p>This protocol for <em>B.subtilis </em>exploits the 10xMC media and the natural competency of <em>B.subtilis </em>to transform the plasmid of interest.</p> | |
− | + | <p>Here, the plasmid has to be linearised before transformation, because pDR111 is a genome integration vector.</p> | |
− | + | <figure class="col-12 col-md-8 my-3 m-auto"> | |
+ | <img src="https://static.igem.org/mediawiki/2021/3/3e/T--IISER-Tirupati_India--Bacillus_subtiils_168_Transformants_-_Spacer_cassette-_Improvement.png" alt="Trulli" style="width:100%"> | ||
+ | </figure> | ||
+ | <figcaption class="text-center">Fig 9. FBacillus subtiils 168 Transformants - BBa_B0010 terminator check cassette- Improvement | ||
+ | Image 1: Control (Without DNA) on LB agar plate with Spectinomycin | ||
+ | Image 2-6: Transformants on LB agar plate with Spectinomycin</figcaption> | ||
+ | <h3 class="mt-3" id="3"><em>Saccharomyces cerevisiae</em> S288C</h3> | ||
+ | |||
+ | <p>Even though we had most things ready for this experiment, we could perform it due to a delay in the delivery of certain important components of growth media required for culturing this strain.</p> | ||
+ | <h2>Protein Purification</h2> | ||
+ | <h3>The mysterious tale of ZP2</h3> | ||
+ | <p>Our goal was to purify ZP2 and Ovastacin during the course of our experiments. Since we had a clone provided by Dr Gupta, we began with our pilot experiment of purification of ZP2 after transforming pRSETB into <em>E.coli BL21</em>.</p> | ||
+ | <p>Since the ZP2 protein was cloned downstream to a T7 promoter which is an IPTG inducible promoter, we began by standardizing the amount of IPTG required for induction of the promoter and purification of ZP2.</p> | ||
+ | <figure class="col-12 col-md-8 my-3 m-auto"> | ||
+ | <img src="https://static.igem.org/mediawiki/2021/9/9b/T--IISER-Tirupati_India--SDS_PAGE-NiNTA_purified_ZP2.png" alt="Trulli" style="width:100%"> | ||
+ | </figure> | ||
+ | <figcaption class="text-center">Fig 10. In this gel, Well 1 has a 10-250kDa ladder. While Well 2 and Well 3 have Elution fraction 1 and Elution fraction 2 respectively. In these we can see the bands for our purified desired protein i.e ZP2. </figcaption> | ||
+ | <p class="mt-3">After standardization of induction, we found that the amount of IPTG required was 1 nM for 2.5 hours.</p> | ||
+ | <p>We further moved to purify ZP2 using IMAC since ZP2 was tagged with a His-tag. The protocol was standardized here as well for binding, washing and elution of the protein.</p> | ||
+ | <figure class="col-12 col-md-8 my-3 m-auto"> | ||
+ | <img src="https://static.igem.org/mediawiki/2021/0/00/T--IISER-Tirupati_India--IPTG_Induction_Check.png" alt="Trulli" style="width:100%"> | ||
+ | </figure> | ||
+ | <figcaption class="text-center">Fig 11. IPTG Induction Check | ||
+ | In this gel, Well 8 has control loaded (resuspended cell pellet of IPTG induced cells). And Well 7 has binding fraction collected after doing binding with cell lysate (sonicated). Then Well 6,5 and 3 are washing fraction 1,2 and 3. Well 4 has a 10-250 kDa protein ladder. Then elution fraction 1 and Elution fraction 2 are loaded in Well 2 and Well 1. Here, we can see the bands of our desired protein in Well 2 and 1 at the position near to 100kDa. We also got some smaller bands in the same Well which was troubleshooted. </figcaption> | ||
+ | |||
+ | <p class="mt-3">This gave us hope for finding ZP2, so we performed a Western blot analysis.</p> | ||
+ | <p>Surprisingly, we found that the purified protein is more than the expected molecular weight.</p> | ||
+ | <figure class="col-12 col-md-8 my-3 m-auto"> | ||
+ | <img src="https://static.igem.org/mediawiki/2021/e/ec/T--IISER-Tirupati_India--Immunoblot-ZP2.png" alt="Trulli" style="width:100%"> | ||
+ | </figure> | ||
+ | <figcaption class="text-center">Fig 12. Immunoblot-ZP2 | ||
+ | After performing immunoblotting, Well 1 consists of a 10-250 kDa protein ladder. While in Well 2 and 3 have Elution fraction 1 and Elution fraction 2. In this blot we can see a band in Well 3 at >120 kDa position, which is suspected to be our desired protein ZP2.</figcaption> | ||
+ | |||
+ | <p class="mt-3">Now, we contacted Dr Gahlay from GNDU, India who was also using the same ZP2 clones provided by Dr Gupta like us. She told us that she was successful in isolating the plasmid from the clones and she was kind enough to send us the isolated plasmid.</p> | ||
+ | <p>We used this plasmid to transform E.coli DH5-alpha to amplify the plasmid and compare it with our previously extracted pRSETB and to E.coli BL21 to purify ZP2.</p> | ||
+ | <p>Using the same protocol for induction, we could observe induction of the promoter and expression of the proteins. ( gel image)</p> | ||
+ | <p>However, the first purification didn’t show any results.</p> | ||
+ | <figure class="col-12 col-md-8 my-3 m-auto"> | ||
+ | <img src="https://static.igem.org/mediawiki/2021/8/81/T--IISER-Tirupati_India--IPTG_Induction-_ZP2_clones-Dr_Gahlay.png" alt="Trulli" style="width:100%"><span id="4"></span> | ||
+ | </figure> | ||
+ | <figcaption class="text-center mb-3">Fig 13. In this gel, well 1 has uninduced resuspended cell pellet, well 2 has 10-250 kDa ladder, well 3 has IPTG induced cell supernatant, well 4 has uninduced cell supernatant</figcaption> | ||
+ | <h2 class="mt-3">Cloning<em> E. coli </em>and <em>B. subtilis</em>(Restriction digestion, Ligation and Gel Extraction)</h2> | ||
+ | <p>Once we received our parts from IDT and Twist in the month of September, we immediately began to assemble the DNA parts.</p> | ||
+ | <p>As we began our assembly process using Golden Gate assembly, we started running to problems and had to go through a lot of cycles of troubleshooting.</p> | ||
+ | <figure class="col-4 col-md-2 my-3 m-auto"> | ||
+ | <img src="https://static.igem.org/mediawiki/2021/2/22/T--IISER-Tirupati_India--1_1.4_agarose.png" alt="Trulli" style="width:100%"> | ||
+ | </figure> | ||
+ | <figcaption class="text-center">Fig 14. Partially ligated golden gate product for Yeast- Ovastacin Cassette | ||
+ | Lane 1: NEB Quick-Load Purple 1kb Plus Ladder | ||
+ | Lane 2: Golden gate constructs for Yeast Zp2-Ovastacin cassette | ||
+ | </figcaption> | ||
− | < | + | <p>We even consulted one of our partners, Team Groningen as they were using the same assembly standards.</p> |
− | + | <p>Finally, after a month of trials with a bunch of restriction digestion, ligation and PCR reactions, we were finally able to assemble our parts.</p> | |
− | + | <figure class="col-12 col-md-8 my-3 m-auto"> | |
− | + | <img src="https://static.igem.org/mediawiki/2021/9/92/T--IISER-Tirupati_India--5_pRS_%28425%2C426%2C424%29_YEAST_PLASMIDS_single_digest_trial_1_%2829_aug%2C_21%29.png" alt="Trulli" style="width:100%"> | |
− | < | + | |
− | + | </figure> | |
− | + | <figcaption class="text-center" style="font-size:small;">Fig 15. pDR111 and Yeast plasmids (pRS424,pRS425, pRS426) restriction digestion check | |
− | + | <br>Lane 1: Gel extracted vector pdr111 (BamHI-HF, EcoRI-HF double digested) sample 1 | |
− | + | <br>Lane 2: Gel extracted vector pdr111 (BamHI-HF, EcoRI-HF double digested) sample 2 | |
− | + | <br>Lane 3: Gel extracted vector pdr111 (BamHI-HF, EcoRI-HF double digested) sample 3 | |
− | + | <br>Lane 4: pDR111 control | |
− | + | Lane 5: Sph1 single digest pdr111 | |
− | + | Lane 6: pRS424 Control | |
− | + | <br>Lane 7: BamHI-HF single digest pRS424 | |
− | + | Lane 8: EcoRI-HF single digest pRS424 | |
− | + | Lane 9: HindIII single digest pRS424 | |
− | + | <br>Lane 10: XbaI single digest pRS424 | |
− | + | Lane 11: NEB Quick-Load Purple 1kb Plus Ladder | |
− | + | Lane 12: pRS425 Control | |
− | + | <br>Lane 13: BamHI-HF single digest pRS425 | |
− | + | Lane 14: HindIII single digest pRS425 | |
− | + | Lane 15: EcoRI-HF single digest pRS425 | |
− | + | <br>Lane 16: pRS426 Control | |
− | + | Lane 17: BamHI-HF single digest pRS426 | |
− | + | Lane 18: HindIII single digest pRS426 | |
− | + | <br>Lane 19: EcoRI-HF single digest pRS426 | |
− | + | Lane 20: PstI single digest pRS426</figcaption> | |
− | + | ||
− | + | <p class="mt-3">We made 8 constructs ( name them) to perform our further assays and transformed these constructs into <em>E. coli </em>NEB10-beta competent cells as they’re known to have higher efficiency.</p> | |
− | + | <p>Some plates showed great colonies, while others either had some contamination or had a low transformation efficiency. </p> | |
− | + | <p>After patching colonies of these transformants to a fresh plate, we ran colony PCR reactions for these clones to confirm the presence of our genes of interest.</p> | |
− | + | <figure class="col-12 col-md-8 my-3 m-auto"> | |
− | + | <img src="https://static.igem.org/mediawiki/2021/7/72/T--IISER-Tirupati_India--6_q5_standardisation_%2820.10.21%29.png" alt="Trulli" style="width:100%"> | |
− | + | </figure> | |
− | + | <figcaption class="text-center">Fig 16. Gradient PCR for Q5 polymerase for pDR111 plasmid <br>with Forward Primer: AAAGGTCATTGTTGACGCGG and Reverse Primer: AAGCCAGGCTGATTCTGACC | |
− | + | <br>Lane 1: 61.1 °C | |
− | + | Lane 2: 61.7 °C | |
− | < | + | Lane 3: 63.2 °C |
− | + | <br>Lane 4: 65.6 °C | |
− | + | Lane 5: 68.6 °C | |
− | < | + | Lane 6: NEB Quick-Load Purple 1kb Plus Ladder |
− | + | <br>Lane 7: 70.9 °C | |
− | + | Lane 8: 72. 4 °C | |
− | < | + | Lane 9: 73.1 °C</figcaption> |
− | + | <p class="mt-3">Initial results showed no positive colonies, but only clear bands of DNA on the gel from the negative control. </p> | |
− | + | <p>Finally, one of the PCR reactions turned out to be great and we observed 2 positive clones for one of our constructs </p> | |
− | + | <figure class="col-8 col-md-4 m-auto"> | |
− | + | <img src="https://static.igem.org/mediawiki/2021/4/4e/T--IISER-Tirupati_India--2_I1_%2Bve.png" alt="Trulli" style="width:100%"> | |
− | < | + | </figure> |
− | + | <figcaption class="text-center mb-3">Fig 17. Suspected Positive clone for Spacer Cassette for Terminator Check | |
− | + | Lane 1: NEB Quick-Load Purple 1kb Plus Ladder | |
− | < | + | Lane 3: Positive clone for Spacer Cassette for Terminator Check |
− | + | Lane 2,4,5,6,7: Negative clones for Spacer Cassette for Terminator Check | |
− | + | </figcaption> | |
− | + | <figure class="col-8 col-md-4 m-auto"> | |
− | + | <img src="https://static.igem.org/mediawiki/2021/6/60/T--IISER-Tirupati_India--3_improvement_gel-2_14.10.2021.png" alt="Trulli" style="width:100%"> | |
− | + | </figure> | |
− | + | <figcaption class="text-center mb-3">Fig 18. Positive clone for B0010 Terminator Check Cassette | |
− | + | Lane 1: NEB Quick-Load Purple 1kb Plus Ladder | |
− | + | Lane 2,8 : Positive Clones for BBa_B0010 terminator check cassette | |
− | + | Lane 3-7, 9-11: Negative Clones for BBa_B0010 terminator check cassette</figcaption> | |
− | + | <figure class="col-8 col-md-4 m-auto"> | |
− | + | <img src="https://static.igem.org/mediawiki/2021/0/0d/T--IISER-Tirupati_India--4_p22srtf_20_to_38_20.10.21.png" alt="Trulli" style="width:100%"> | |
− | + | </figure> | |
− | + | <figcaption class="text-center mb-3"><span id="5"></span> 20. Suspected Positive clone for SRTF1-P22 combined Cassette | |
− | + | Lane 1: Suspected positive clone for SRTF-P22 combined cassette | |
− | + | Lane 6: NEB Quick-Load Purple 1kb Plus Ladder | |
− | + | Lane 2-5: Negative clone for SRTF-P22 combined cassette</figcaption> | |
− | + | <p>We purified the plasmid from these colonies and transformed them into <em>B.subtilis</em> for fluorescence assay. </p> | |
− | + | <h2>Summary</h2> | |
− | + | ||
− | + | ||
</div> | </div> | ||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
− | |||
</div> | </div> | ||
+ | <button type="button" class="btn button-dark btn-floating btn-lg" id="btn-back-to-top"><svg fill="#FDF8D7" width="20px" height="30px" xmlns="http://www.w3.org/2000/svg" viewBox="0 0 448 512"><path d="M34.9 289.5l-22.2-22.2c-9.4-9.4-9.4-24.6 0-33.9L207 39c9.4-9.4 24.6-9.4 33.9 0l194.3 194.3c9.4 9.4 9.4 24.6 0 33.9L413 289.4c-9.5 9.5-25 9.3-34.3-.4L264 168.6V456c0 13.3-10.7 24-24 24h-32c-13.3 0-24-10.7-24-24V168.6L69.2 289.1c-9.3 9.8-24.8 10-34.3.4z"/></svg></button> | ||
</main> | </main> | ||
− | |||
Line 310: | Line 336: | ||
<img class="img igemiiser" src="https://static.igem.org/mediawiki/2021/e/e0/T--IISER-Tirupati_India--IgemIiser.svg" style="width: 100%;"> | <img class="img igemiiser" src="https://static.igem.org/mediawiki/2021/e/e0/T--IISER-Tirupati_India--IgemIiser.svg" style="width: 100%;"> | ||
</div> | </div> | ||
− | <div class="col-12 col-md-6 | + | <div class="col-12 col-md-6"> |
<h5 class="pt-3 text-center">Our Sponsors</h5> | <h5 class="pt-3 text-center">Our Sponsors</h5> | ||
− | <div class="row justify-content-center align-items-center pb- | + | <div class="row justify-content-center align-items-center pb-3"> |
− | <div class="col- | + | <div class="col-2"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/a/a3/T--IISER-Tirupati_India--IISERT.svg"></div> |
− | <div class="col- | + | <div class="col-2"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/7/7a/T--IISER-Tirupati_India--ISC.jpeg"></div> |
− | <div class="col- | + | <div class="col-2"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/b/be/T--IISER-Tirupati_India--broslogo.jpeg"></div> |
− | + | <div class="col-2"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/0/0b/T--IISER-Tirupati_India--GenScript.svg"></div> | |
+ | <div class="col-2"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/0/0d/T--IISER-Tirupati_India--NEB.svg"></div> | ||
</div> | </div> | ||
<div class="row justify-content-center"> | <div class="row justify-content-center"> | ||
− | <div class="col- | + | <div class="col-2"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/7/76/T--IISER-Tirupati_India--Geneious.svg"></div> |
− | <div class="col- | + | <div class="col-2"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/9/99/T--IISER-Tirupati_India--Twist.svg"></div> |
− | <div class="col- | + | <div class="col-2"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/6/6b/T--IISER-Tirupati_India--Invideo.svg"></div> |
− | <div class="col- | + | <div class="col-2"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/0/06/T--IISER-Tirupati_India--Benchling.svg"></div> |
+ | <div class="col-2"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/6/6b/T--IISER-Tirupati_India--IDT.svg"></div> | ||
</div> | </div> | ||
</div> | </div> | ||
Line 331: | Line 359: | ||
<div class="row"> | <div class="row"> | ||
<ul class="social d-flex flex-wrap justify-content-center"> | <ul class="social d-flex flex-wrap justify-content-center"> | ||
− | <li style="list-style: none;"><a href="https://www.facebook.com/igemiisertpt/"><svg class="icon" width="30px" height="30px" xmlns="http://www.w3.org/2000/svg" viewBox="0 0 320 512"><path d="M279.14 288l14.22-92.66h-88.91v-60.13c0-25.35 12.42-50.06 52.24-50.06h40.42V6.26S260.43 0 225.36 0c-73.22 0-121.08 44.38-121.08 124.72v70.62H22.89V288h81.39v224h100.17V288z"/></svg></a></li> | + | <li style="list-style: none;"><a target="_blank" href="https://www.facebook.com/igemiisertpt/"><svg class="icon" width="30px" height="30px" xmlns="http://www.w3.org/2000/svg" viewBox="0 0 320 512"><path d="M279.14 288l14.22-92.66h-88.91v-60.13c0-25.35 12.42-50.06 52.24-50.06h40.42V6.26S260.43 0 225.36 0c-73.22 0-121.08 44.38-121.08 124.72v70.62H22.89V288h81.39v224h100.17V288z"/></svg></a></li> |
− | <li style="list-style: none;"><a href="https://twitter.com/IIisert?t=Ah9Os-I3akvyn4kHbPSgTw&s=09"><svg class="icon" width="30px" height="30px" xmlns="http://www.w3.org/2000/svg" viewBox="0 0 512 512"><path d="M459.37 151.716c.325 4.548.325 9.097.325 13.645 0 138.72-105.583 298.558-298.558 298.558-59.452 0-114.68-17.219-161.137-47.106 8.447.974 16.568 1.299 25.34 1.299 49.055 0 94.213-16.568 130.274-44.832-46.132-.975-84.792-31.188-98.112-72.772 6.498.974 12.995 1.624 19.818 1.624 9.421 0 18.843-1.3 27.614-3.573-48.081-9.747-84.143-51.98-84.143-102.985v-1.299c13.969 7.797 30.214 12.67 47.431 13.319-28.264-18.843-46.781-51.005-46.781-87.391 0-19.492 5.197-37.36 14.294-52.954 51.655 63.675 129.3 105.258 216.365 109.807-1.624-7.797-2.599-15.918-2.599-24.04 0-57.828 46.782-104.934 104.934-104.934 30.213 0 57.502 12.67 76.67 33.137 23.715-4.548 46.456-13.32 66.599-25.34-7.798 24.366-24.366 44.833-46.132 57.827 21.117-2.273 41.584-8.122 60.426-16.243-14.292 20.791-32.161 39.308-52.628 54.253z"/></svg></a></li> | + | <li style="list-style: none;"><a target="_blank" href="https://twitter.com/IIisert?t=Ah9Os-I3akvyn4kHbPSgTw&s=09"><svg class="icon" width="30px" height="30px" xmlns="http://www.w3.org/2000/svg" viewBox="0 0 512 512"><path d="M459.37 151.716c.325 4.548.325 9.097.325 13.645 0 138.72-105.583 298.558-298.558 298.558-59.452 0-114.68-17.219-161.137-47.106 8.447.974 16.568 1.299 25.34 1.299 49.055 0 94.213-16.568 130.274-44.832-46.132-.975-84.792-31.188-98.112-72.772 6.498.974 12.995 1.624 19.818 1.624 9.421 0 18.843-1.3 27.614-3.573-48.081-9.747-84.143-51.98-84.143-102.985v-1.299c13.969 7.797 30.214 12.67 47.431 13.319-28.264-18.843-46.781-51.005-46.781-87.391 0-19.492 5.197-37.36 14.294-52.954 51.655 63.675 129.3 105.258 216.365 109.807-1.624-7.797-2.599-15.918-2.599-24.04 0-57.828 46.782-104.934 104.934-104.934 30.213 0 57.502 12.67 76.67 33.137 23.715-4.548 46.456-13.32 66.599-25.34-7.798 24.366-24.366 44.833-46.132 57.827 21.117-2.273 41.584-8.122 60.426-16.243-14.292 20.791-32.161 39.308-52.628 54.253z"/></svg></a></li> |
− | <li style="list-style: none;"><a href="https://instagram.com/igem_iisertirupati?utm_medium=copy_link"><svg class="icon" width="30px" height="30px" xmlns="http://www.w3.org/2000/svg" viewBox="0 0 448 512"><path d="M224.1 141c-63.6 0-114.9 51.3-114.9 114.9s51.3 114.9 114.9 114.9S339 319.5 339 255.9 287.7 141 224.1 141zm0 189.6c-41.1 0-74.7-33.5-74.7-74.7s33.5-74.7 74.7-74.7 74.7 33.5 74.7 74.7-33.6 74.7-74.7 74.7zm146.4-194.3c0 14.9-12 26.8-26.8 26.8-14.9 0-26.8-12-26.8-26.8s12-26.8 26.8-26.8 26.8 12 26.8 26.8zm76.1 27.2c-1.7-35.9-9.9-67.7-36.2-93.9-26.2-26.2-58-34.4-93.9-36.2-37-2.1-147.9-2.1-184.9 0-35.8 1.7-67.6 9.9-93.9 36.1s-34.4 58-36.2 93.9c-2.1 37-2.1 147.9 0 184.9 1.7 35.9 9.9 67.7 36.2 93.9s58 34.4 93.9 36.2c37 2.1 147.9 2.1 184.9 0 35.9-1.7 67.7-9.9 93.9-36.2 26.2-26.2 34.4-58 36.2-93.9 2.1-37 2.1-147.8 0-184.8zM398.8 388c-7.8 19.6-22.9 34.7-42.6 42.6-29.5 11.7-99.5 9-132.1 9s-102.7 2.6-132.1-9c-19.6-7.8-34.7-22.9-42.6-42.6-11.7-29.5-9-99.5-9-132.1s-2.6-102.7 9-132.1c7.8-19.6 22.9-34.7 42.6-42.6 29.5-11.7 99.5-9 132.1-9s102.7-2.6 132.1 9c19.6 7.8 34.7 22.9 42.6 42.6 11.7 29.5 9 99.5 9 132.1s2.7 102.7-9 132.1z"/></svg></a></li> | + | <li style="list-style: none;"><a target="_blank" href="https://instagram.com/igem_iisertirupati?utm_medium=copy_link"><svg class="icon" width="30px" height="30px" xmlns="http://www.w3.org/2000/svg" viewBox="0 0 448 512"><path d="M224.1 141c-63.6 0-114.9 51.3-114.9 114.9s51.3 114.9 114.9 114.9S339 319.5 339 255.9 287.7 141 224.1 141zm0 189.6c-41.1 0-74.7-33.5-74.7-74.7s33.5-74.7 74.7-74.7 74.7 33.5 74.7 74.7-33.6 74.7-74.7 74.7zm146.4-194.3c0 14.9-12 26.8-26.8 26.8-14.9 0-26.8-12-26.8-26.8s12-26.8 26.8-26.8 26.8 12 26.8 26.8zm76.1 27.2c-1.7-35.9-9.9-67.7-36.2-93.9-26.2-26.2-58-34.4-93.9-36.2-37-2.1-147.9-2.1-184.9 0-35.8 1.7-67.6 9.9-93.9 36.1s-34.4 58-36.2 93.9c-2.1 37-2.1 147.9 0 184.9 1.7 35.9 9.9 67.7 36.2 93.9s58 34.4 93.9 36.2c37 2.1 147.9 2.1 184.9 0 35.9-1.7 67.7-9.9 93.9-36.2 26.2-26.2 34.4-58 36.2-93.9 2.1-37 2.1-147.8 0-184.8zM398.8 388c-7.8 19.6-22.9 34.7-42.6 42.6-29.5 11.7-99.5 9-132.1 9s-102.7 2.6-132.1-9c-19.6-7.8-34.7-22.9-42.6-42.6-11.7-29.5-9-99.5-9-132.1s-2.6-102.7 9-132.1c7.8-19.6 22.9-34.7 42.6-42.6 29.5-11.7 99.5-9 132.1-9s102.7-2.6 132.1 9c19.6 7.8 34.7 22.9 42.6 42.6 11.7 29.5 9 99.5 9 132.1s2.7 102.7-9 132.1z"/></svg></a></li> |
− | <li style="list-style: none;"><a href="https://www.youtube.com/channel/UCNbypAD0B8ksHy9A4vxFr1A"><svg class="icon" width="30px" height="30px" xmlns="http://www.w3.org/2000/svg" viewBox="0 0 576 512"><path d="M549.655 124.083c-6.281-23.65-24.787-42.276-48.284-48.597C458.781 64 288 64 288 64S117.22 64 74.629 75.486c-23.497 6.322-42.003 24.947-48.284 48.597-11.412 42.867-11.412 132.305-11.412 132.305s0 89.438 11.412 132.305c6.281 23.65 24.787 41.5 48.284 47.821C117.22 448 288 448 288 448s170.78 0 213.371-11.486c23.497-6.321 42.003-24.171 48.284-47.821 11.412-42.867 11.412-132.305 11.412-132.305s0-89.438-11.412-132.305zm-317.51 213.508V175.185l142.739 81.205-142.739 81.201z"/></svg></a></li> | + | <li style="list-style: none;"><a target="_blank" href="https://www.youtube.com/channel/UCNbypAD0B8ksHy9A4vxFr1A"><svg class="icon" width="30px" height="30px" xmlns="http://www.w3.org/2000/svg" viewBox="0 0 576 512"><path d="M549.655 124.083c-6.281-23.65-24.787-42.276-48.284-48.597C458.781 64 288 64 288 64S117.22 64 74.629 75.486c-23.497 6.322-42.003 24.947-48.284 48.597-11.412 42.867-11.412 132.305-11.412 132.305s0 89.438 11.412 132.305c6.281 23.65 24.787 41.5 48.284 47.821C117.22 448 288 448 288 448s170.78 0 213.371-11.486c23.497-6.321 42.003-24.171 48.284-47.821 11.412-42.867 11.412-132.305 11.412-132.305s0-89.438-11.412-132.305zm-317.51 213.508V175.185l142.739 81.205-142.739 81.201z"/></svg></a></li> |
</ul> | </ul> | ||
</div> | </div> | ||
Line 352: | Line 380: | ||
<div class="d-flex flex-column"> | <div class="d-flex flex-column"> | ||
<a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Description">DESCRIPTION</a> | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Description">DESCRIPTION</a> | ||
− | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/ | + | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Blueprint">BLUEPRINT</a> |
<a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Engineering">ENGINEERING</a> | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Engineering">ENGINEERING</a> | ||
<a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Background">BACKGROUND</a> | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Background">BACKGROUND</a> | ||
Line 363: | Line 391: | ||
<div class="d-flex flex-column"> | <div class="d-flex flex-column"> | ||
<a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Proof_Of_Concept">PROOF OF CONCEPT</a> | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Proof_Of_Concept">PROOF OF CONCEPT</a> | ||
− | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Design"> | + | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Design">DESIGN</a> |
<a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Parts">PARTS</a> | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Parts">PARTS</a> | ||
<a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Results">RESULTS</a> | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Results">RESULTS</a> |
Revision as of 16:25, 21 October 2021
The wet lab team of Team IISER-Tirupati_India arrived on campus in the last week of July and saw their undergraduate Biology lab after 1.5 years, which felt like ages had passed.
We were determined and hopeful to produce results for our Proof of Concept. With ample preparation of protocols, ordering all consumables, discussions with seniors and advice from our PIs, we thought we were set for all kinds of experiments.
However, with the COVID-19 pandemic at large, we had very limited hours of access to the lab and we began with laboratory safety training conducted by our technical assistants. Then we started our wet lab journey acclimatizing with all laboratory techniques and instruments first. The pandemic delayed the process of acquiring resources including reagents and DNA from our kind sponsors IDT and Twist Bioscience which was a major roadblock for us. We received our DNA in mid-September and picked up the pace, only to realise that 2 months of lab access might not be enough to complete all our experiments.
Nevertheless, we are proud that the wet lab members have worked day-in and day-out to work towards making an attempt towards successful producing results and gaining knowledge and experience of research in synthetic biology.
We had a bunch of successful experiments, but a pile of failed ones as well. This page talks about our journey of those 2 months in the laboratory and the amount of background work put together by the entire team to try and actualise OviCloak.
Results of Basic Experiments
Our team performed some preliminary experiments in the first few weeks.
Growth curves
Escherichia coli DH5-alpha
![Trulli](https://static.igem.org/mediawiki/2021/f/ff/T--IISER-Tirupati_India--E_coli_growth_curve.png)
![Trulli](https://static.igem.org/mediawiki/2021/9/9b/T--IISER-Tirupati_India--E_coli_growth_curve2.png)
![Trulli](https://static.igem.org/mediawiki/2021/1/15/T--IISER-Tirupati_India--E_coli_growth_curve_comparison.png)
The growth curves had unusual data points for the OD at 600 when observed at different time points. However, we could observe a trend in the curve and we could use this as a reference for our future experiments.
We do realise that this is not the ideal or the best curve.
Bacillus subtilis 168
![Trulli](https://static.igem.org/mediawiki/2021/b/be/T--IISER-Tirupati_India--B_subtilis_growth_curve.png)
This was one of the first experiments that we performed and the results turned out to be quite close to the expected results, not the best though.
We could infer that Bacillus subtilis 168 enters the stationary phase between 6-7 hours after inoculation.
This was crucial information that we utilised for our experiment of the Transformation of B. subtilis 168 with our plasmid of interest.
Saccharomyces cerevisiae S288C
![Trulli](https://static.igem.org/mediawiki/2021/d/d3/T--IISER-Tirupati_India--Yeast_growth_curve_1.png)
![Trulli](https://static.igem.org/mediawiki/2021/8/86/T--IISER-Tirupati_India--Yeast_growth_curve_2.png)
![Trulli](https://static.igem.org/mediawiki/2021/1/1b/T--IISER-Tirupati_India--Yeast_growth_curve_comparison.png)
These 24-hours growth curves of Saccharomyces cerevisiae S288C, (with some abrupt data points) show a similar trend.
Important pointers:
- Growth curves need to be standardized by all labs, even if 2 labs share the same strain of the organism
- Growth curves are an easy and effective way to study the nature and behaviour of an organism in a particular given environment.
- All the above growth curves were observed in nutrient-rich media (LB for bacterial strains and YPD for S.cerevisiae)
Plasmid Isolation
With the E.coli clones that Dr SK Gupta from National Institute of Immunology, India for ZP2 cloned in pRSETB, Dr Sabari from IISER Thiruvananthapuram for pDR111 and pDR110 vectors and the ones that Dr Vijayalakshmi from IISER Tirupati for pRS426, our team began to isolate these plasmids for our future cloning experiments.
After several optimisations in our protocol, we could efficiently isolate plasmids. Our average concentration of DNA started to be around 100-150 ng/ul and our most efficient concentration was 6969 ng/ul
Preparation of competent cells and transformation
Escherichia coliDH5-alpha and Escherichia coliBL21
Our team was extremely excited to get competent E.coli DH5-alpha and E.coli BL21 cells in our FIRST attempt.
We’re thankful to the VD lab for helping us with the chemical competency protocol. We verified the DH5-alpha competency of the cells, by transforming empty backbone pDR111 isolated earlier and likewise for BL21, we transformed pRSETB containing ZP2 protein to verify their competency.
![Trulli](https://static.igem.org/mediawiki/2021/5/5c/T--IISER-Tirupati_India--Escherichia_coli_DH5%CE%B1_Transformants_-_pRSETB_with_ZP2_gene.png)
Bacillus subtilis 168
With the B.subtilis strain and protocols provided by Dr Sabari, we were able to successfully transform pDR111 empty backbone, pDR111 containing genes of interest and confirm genome integration of the antibiotic-resistant gene.
This protocol for B.subtilis exploits the 10xMC media and the natural competency of B.subtilis to transform the plasmid of interest.
Here, the plasmid has to be linearised before transformation, because pDR111 is a genome integration vector.
![Trulli](https://static.igem.org/mediawiki/2021/3/3e/T--IISER-Tirupati_India--Bacillus_subtiils_168_Transformants_-_Spacer_cassette-_Improvement.png)
Saccharomyces cerevisiae S288C
Even though we had most things ready for this experiment, we could perform it due to a delay in the delivery of certain important components of growth media required for culturing this strain.
Protein Purification
The mysterious tale of ZP2
Our goal was to purify ZP2 and Ovastacin during the course of our experiments. Since we had a clone provided by Dr Gupta, we began with our pilot experiment of purification of ZP2 after transforming pRSETB into E.coli BL21.
Since the ZP2 protein was cloned downstream to a T7 promoter which is an IPTG inducible promoter, we began by standardizing the amount of IPTG required for induction of the promoter and purification of ZP2.
![Trulli](https://static.igem.org/mediawiki/2021/9/9b/T--IISER-Tirupati_India--SDS_PAGE-NiNTA_purified_ZP2.png)
After standardization of induction, we found that the amount of IPTG required was 1 nM for 2.5 hours.
We further moved to purify ZP2 using IMAC since ZP2 was tagged with a His-tag. The protocol was standardized here as well for binding, washing and elution of the protein.
![Trulli](https://static.igem.org/mediawiki/2021/0/00/T--IISER-Tirupati_India--IPTG_Induction_Check.png)
This gave us hope for finding ZP2, so we performed a Western blot analysis.
Surprisingly, we found that the purified protein is more than the expected molecular weight.
![Trulli](https://static.igem.org/mediawiki/2021/e/ec/T--IISER-Tirupati_India--Immunoblot-ZP2.png)
Now, we contacted Dr Gahlay from GNDU, India who was also using the same ZP2 clones provided by Dr Gupta like us. She told us that she was successful in isolating the plasmid from the clones and she was kind enough to send us the isolated plasmid.
We used this plasmid to transform E.coli DH5-alpha to amplify the plasmid and compare it with our previously extracted pRSETB and to E.coli BL21 to purify ZP2.
Using the same protocol for induction, we could observe induction of the promoter and expression of the proteins. ( gel image)
However, the first purification didn’t show any results.
![Trulli](https://static.igem.org/mediawiki/2021/8/81/T--IISER-Tirupati_India--IPTG_Induction-_ZP2_clones-Dr_Gahlay.png)
Cloning E. coli and B. subtilis(Restriction digestion, Ligation and Gel Extraction)
Once we received our parts from IDT and Twist in the month of September, we immediately began to assemble the DNA parts.
As we began our assembly process using Golden Gate assembly, we started running to problems and had to go through a lot of cycles of troubleshooting.
![Trulli](https://static.igem.org/mediawiki/2021/2/22/T--IISER-Tirupati_India--1_1.4_agarose.png)
We even consulted one of our partners, Team Groningen as they were using the same assembly standards.
Finally, after a month of trials with a bunch of restriction digestion, ligation and PCR reactions, we were finally able to assemble our parts.
![Trulli](https://static.igem.org/mediawiki/2021/9/92/T--IISER-Tirupati_India--5_pRS_%28425%2C426%2C424%29_YEAST_PLASMIDS_single_digest_trial_1_%2829_aug%2C_21%29.png)
Lane 1: Gel extracted vector pdr111 (BamHI-HF, EcoRI-HF double digested) sample 1
Lane 2: Gel extracted vector pdr111 (BamHI-HF, EcoRI-HF double digested) sample 2
Lane 3: Gel extracted vector pdr111 (BamHI-HF, EcoRI-HF double digested) sample 3
Lane 4: pDR111 control Lane 5: Sph1 single digest pdr111 Lane 6: pRS424 Control
Lane 7: BamHI-HF single digest pRS424 Lane 8: EcoRI-HF single digest pRS424 Lane 9: HindIII single digest pRS424
Lane 10: XbaI single digest pRS424 Lane 11: NEB Quick-Load Purple 1kb Plus Ladder Lane 12: pRS425 Control
Lane 13: BamHI-HF single digest pRS425 Lane 14: HindIII single digest pRS425 Lane 15: EcoRI-HF single digest pRS425
Lane 16: pRS426 Control Lane 17: BamHI-HF single digest pRS426 Lane 18: HindIII single digest pRS426
Lane 19: EcoRI-HF single digest pRS426 Lane 20: PstI single digest pRS426
We made 8 constructs ( name them) to perform our further assays and transformed these constructs into E. coli NEB10-beta competent cells as they’re known to have higher efficiency.
Some plates showed great colonies, while others either had some contamination or had a low transformation efficiency.
After patching colonies of these transformants to a fresh plate, we ran colony PCR reactions for these clones to confirm the presence of our genes of interest.
![Trulli](https://static.igem.org/mediawiki/2021/7/72/T--IISER-Tirupati_India--6_q5_standardisation_%2820.10.21%29.png)
with Forward Primer: AAAGGTCATTGTTGACGCGG and Reverse Primer: AAGCCAGGCTGATTCTGACC
Lane 1: 61.1 °C Lane 2: 61.7 °C Lane 3: 63.2 °C
Lane 4: 65.6 °C Lane 5: 68.6 °C Lane 6: NEB Quick-Load Purple 1kb Plus Ladder
Lane 7: 70.9 °C Lane 8: 72. 4 °C Lane 9: 73.1 °C
Initial results showed no positive colonies, but only clear bands of DNA on the gel from the negative control.
Finally, one of the PCR reactions turned out to be great and we observed 2 positive clones for one of our constructs
![Trulli](https://static.igem.org/mediawiki/2021/4/4e/T--IISER-Tirupati_India--2_I1_%2Bve.png)
![Trulli](https://static.igem.org/mediawiki/2021/6/60/T--IISER-Tirupati_India--3_improvement_gel-2_14.10.2021.png)
![Trulli](https://static.igem.org/mediawiki/2021/0/0d/T--IISER-Tirupati_India--4_p22srtf_20_to_38_20.10.21.png)
We purified the plasmid from these colonies and transformed them into B.subtilis for fluorescence assay.
Summary
Our Sponsors
![](https://static.igem.org/mediawiki/2021/7/7a/T--IISER-Tirupati_India--ISC.jpeg)
![](https://static.igem.org/mediawiki/2021/b/be/T--IISER-Tirupati_India--broslogo.jpeg)