Team:IISER-Tirupati India/Results
India was gripped by the novel coronavirus in the deadly second wave of the pandemic, earlier this year. This devastating period of the ongoing pandemic delayed our plans and the wetlab team could arrive on campus and get access to the lab only in the last week of July after more than six months of planning the project.
Though we had hardly two months in our hands to achieve our experimental goals, we were determined and hopeful to try and obtain results for our Proof of Concept. With ample preparation of protocols, ordering all consumables, discussions with seniors, and advice from our PIs, we thought we were set for all kinds of experiments.
The safety guidelines issued during the COVID-19 pandemic also limited our hours of access to the lab. We began with laboratory safety training conducted by our technical assistants. The pandemic also significantly delayed the process of acquiring resources including reagents and DNA from our kind sponsors IDT and Twist Bioscience which was a major roadblock for us. We received our DNA in mid-September and picked up the pace, only to realise that 2 months of lab access might not be enough to conduct all our experiments.
We had a bunch of successful experiments, but a pile of failed ones as well (that’s how science works, isn’t it?). This page talks about our journey of those two months in the laboratory and the amount of background work put together by the entire team to try and actualise OviCloak.
Results of Basic Experiments
Our team performed some preliminary experiments in the first few weeks.
Growth curves
Escherichia coli DH5-α
We could observe a trend in the curve and we could use this as a reference for our future experiments. However, the growth curves had unusual data points for the OD at 600 nm when observed at different time points.
We realise that this is not the ideal or the best representation of a growth curve.
Bacillus subtilis 168
Upon performing a growth curve experiment using Bacillus subtilis 168 in LB, we observed an expected sigmoidal pattern of growth. From the graph, we could infer that the bacteria enters the stationary phase after 6 hours from inoculation. Using this value for the stationary phase as a reference, we further performed transformation experiments of B. subtilis 168 with our plasmid of interest.
Saccharomyces cerevisiae S288C
These 24-hours growth curves of Saccharomyces cerevisiae S288C in YPD, show a similar trend of a sigmoidal growth (with a few outliers).
Important pointers:
- Growth curves need to be standardized by all labs, even if 2 labs share the same strain of the organism
- Growth curves are an easy and effective way to study the nature and behaviour of an organism in a particular given environment.
- All the above growth curves were observed in nutrient-rich media (LB for bacterial strains and YPD for S. cerevisiae)
Plasmid Isolation
After receiving the E. coli clones for ZP2 in pRSET-B vector (generously provided by Dr SK Gupta from NII, India), pDR111 and pDR110 vectors (generously provided by Dr Sabari from IISER Thiruvananthapuram) and the plasmids for pRS426 (generously shared by Dr Vijayalakshmi Subramanian, from IISER Tirupati) our team set forth to isolate these plasmids for our future cloning experiments.
Preparation of competent cells and transformation
Escherichia coli DH5-α and Escherichia coli BL21
We used the chemical competency method to obtain competent E. coli DH5α and E. coli BL21 cells. We verified the competency of DH5α cells, by transforming empty backbone pDR111 isolated earlier. Likewise to check the competency of BL21 cells, we transformed pRSETB containing ZP2 protein.
Bacillus subtilis 168
With the B.subtilis strain and protocols provided by Dr Sabari, we were able to successfully transform pDR111 empty backbone and pDR111 containing genes of interest and verified genome integration of the antibiotic-resistant gene.
This protocol for B. subtilis exploits the 10xMC media and the natural competency of B.subtilis to transform the plasmid of interest.
Here, the plasmid has to be linearised before transformation, because pDR111 is compatible for genome integration.
Saccharomyces cerevisiae S288C
We couldn’t perform this experiment due to a delay in the delivery of certain important growth media requirements for culturing this strain.
Protein Purification
The mysterious tale of ZP2
Our goal was to purify ZP2 and ovastacin during the course of our experiments. Since we had a clone provided by Dr Gupta, we began with our pilot experiment of IMAC protein purification of His-tagged ZP2 after transforming pRSETB into E. coli BL21.
Since the ZP2 protein was cloned downstream to a T7 promoter which is an IPTG inducible promoter, we began by standardizing the amount of IPTG required for induction of the promoter and purification of ZP2.
After standardization of induction, we found that the amount of IPTG required was 1 nM for 2.5 hours. This was in accordance with literature that we got from Dr Satish Gupta’s work with the same clones.
We further moved to purify ZP2 using IMAC for His-tagged ZP2 protein. The protocol was standardized here as well for binding, washing and elution of the protein.
We went ahead with Immunoblot analysis to verify the presence of His-tagged protein using antibodies.
We found that the purified protein is more than the expected molecular weight and tried to troubleshoot our experiments.
To rule out any chances of mutations in the plasmid, we contacted Dr Gahlay from GNDU, India who was also using the same ZP2 clones. We obtained another set of the purified plasmid from her and carried out further experiments
We used this plasmid to transform E.coli DH5-α to amplify the plasmid and compared it with our previously extracted pRSETB. We further transformed E.coli BL21 cells to purify ZP2 protein.
Using the same protocol for induction, we could observe induction of the promoter and expression of the protein.
We went ahead with Ni-NTA IMAC purification of the His-tagged ZP2 and optimization of the protocol is still under progress.
Cloning E. coli and B. subtilis (Restriction digestion, Ligation and Gel Extraction)
Once we received our parts from IDT and Twist in the month of September, we began to assemble the DNA parts.
Initially we didn't obtain bands of desired sizes on the gel when we began our cloning process with Golden Gate assembly and hence we went through several cycles of troubleshooting.
We also discussed the protocol with one of our partners, Team Groningen as they were using the same assembly standards.
After integrating the suggested modifications to our protocol for Golden Gate assembly, we were able to assemble our desired constructs.
We made 8 constructs to perform our further assays and transformed these constructs into E. coli NEB10-beta competent cells as they’re known to have higher transformation efficiency.
We obtained plates with good number of colonies after incubation following transformation.
For standardization of primers to be used for amplification of genes of interest, we performed gradient PCR. We observed intense bands at temperature 65.6 °C and 68.6 °C, hence we went ahead with a temperature of 66 °C for further PCR.
To further confirm the presence of our genes of interest in our obtained colonies, we patched the colonies of these transformants to a fresh plate and performed colony PCR reactions on randomly selected clones.
with Forward Primer: AAAGGTCATTGTTGACGCGG and Reverse Primer: AAGCCAGGCTGATTCTGACC
Lane 1: 61.1 °C Lane 2: 61.7 °C Lane 3: 63.2 °C
Lane 4: 65.6 °C Lane 5: 68.6 °C Lane 6: NEB Quick-Load Purple 1kb Plus Ladder
Lane 7: 70.9 °C Lane 8: 72. 4 °C Lane 9: 73.1 °C
Upon running the products of PCR reactions on the gel we observed 2 positive clones for one of our constructs.
Fluorescence assay
Attempt to Improvement of a part
We purified the plasmid from these colonies and transformed them into B. subtilis for fluorescence assay.
Under a confocal microscope, we could observe the expression of sfGFP and mCherry and observe their differences in fluorescence intensities signifying that BBa_B0010 works in Bacillus subtilis.
Progesterone sensing
In this graph, SRTF1 cassette (BBa_K3889100) and P22 Cassette (BBa_K3889101) were co-expressed in Bacillus subtilis 168 consisting of SRTF1 with mCherry reporter and P22 Cassette with Azurite reporter under various concentrations of progesterone.
Unexpectedly, the mCherry expression decreased at higher concentrations of progesterone. Further experimental evidence is needed to determine the cause. Additionally, the Azurite expression increased with progesterone levels signifying that p22 protein production increased. Hence, this evidence suggests that SRTF1 and SRTF1 DNA binding sites were interacting as expected, and progesterone sensing is taking place in Bacillus subtilis 168.
Our Sponsors
