Line 1: | Line 1: | ||
− | <! | + | |
− | + | <!--{{IGEM_TopBar}}--> | |
− | + | {{IISER-Tirupati India}} | |
− | + | <html> | |
− | + | <link rel="stylesheet" type="text/css" href="https://2021.igem.org/wiki/index.php?title=Template:IISER-Tirupati India/Bootstrap.css&action=raw&ctype=text/css" /> | |
− | + | ||
− | + | <link rel="stylesheet" type="text/css" href="https://2021.igem.org/wiki/index.php?title=Template:IISER-Tirupati India/AOS/CSS&action=raw&ctype=text/css" /> | |
− | + | ||
− | + | <link rel="stylesheet" type="text/css" href="https://2021.igem.org/wiki/index.php?title=Template:IISER-Tirupati India/style.css&action=raw&ctype=text/css" /> | |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
− | + | ||
<script type="text/x-mathjax-config"> | <script type="text/x-mathjax-config"> | ||
MathJax.Hub.Config({ | MathJax.Hub.Config({ | ||
Line 25: | Line 16: | ||
}); | }); | ||
</script> | </script> | ||
− | + | <script src="https://2021.igem.org/common/MathJax-2.5-latest/MathJax.js?config=TeX-AMS-MML_HTMLorMML"></script> | |
− | + | ||
− | </script | + | |
− | + | ||
− | |||
− | |||
− | <div class="wrapper"> | + | <div class="wrapper" style="background-color: #FDF8D7;"> |
<header> | <header> | ||
− | <section> | + | <section class="container-fluid" style="background-color: #8D1063;"> |
− | <img class="img img-fluid" src="./ | + | <img class="img img-fluid" src="https://static.igem.org/mediawiki/2021/9/97/T--IISER-Tirupati_India--CONTRIBUTION-01.svg" style="width: 100%;"> |
− | + | ||
− | + | ||
− | + | ||
− | + | ||
<div class=" row justify-content-center d-none d-lg-flex" style="width: 100% !important;"> | <div class=" row justify-content-center d-none d-lg-flex" style="width: 100% !important;"> | ||
<div class="down-arrow" style="color: hsl(320, 80%, 31%);"><strong>SCROLL</strong> | <div class="down-arrow" style="color: hsl(320, 80%, 31%);"><strong>SCROLL</strong> | ||
Line 54: | Line 36: | ||
<nav class="navbar navbar-expand-lg navbar-dark fixed-top" id="navbar" style="background-color:rgb(25, 25, 25);"> | <nav class="navbar navbar-expand-lg navbar-dark fixed-top" id="navbar" style="background-color:rgb(25, 25, 25);"> | ||
<div class="container"> | <div class="container"> | ||
− | <a class="navbar-brand" href=" | + | <a class="navbar-brand" href="https://2021.igem.org/Team:IISER-Tirupati_India"><img class="img" src="https://static.igem.org/mediawiki/2021/e/ef/T--IISER-Tirupati_India--Ovicloak.svg" style="height: 50px;"></a> |
+ | <a class="navbar-brand display-2" style="margin-right: auto;" href="https://2021.igem.org/Team:IISER-Tirupati_India">OviCloak</a> | ||
+ | |||
+ | |||
<button class="navbar-toggler" type="button" data-bs-toggle="collapse" data-bs-target="#navbarSupportedContent" aria-controls="navbarSupportedContent" aria-expanded="false" aria-label="Toggle navigation"> | <button class="navbar-toggler" type="button" data-bs-toggle="collapse" data-bs-target="#navbarSupportedContent" aria-controls="navbarSupportedContent" aria-expanded="false" aria-label="Toggle navigation"> | ||
<span class="navbar-toggler-icon"></span> | <span class="navbar-toggler-icon"></span> | ||
Line 60: | Line 45: | ||
<div class="collapse navbar-collapse" id="navbarSupportedContent"> | <div class="collapse navbar-collapse" id="navbarSupportedContent"> | ||
<ul class="navbar-nav ms-auto"> | <ul class="navbar-nav ms-auto"> | ||
− | <li class="nav-item dropdown"> | + | <li class="nav-item dropdown" style="padding-right: 10px;"> |
− | <a class="nav-link | + | <a class="nav-link" href="https://2021.igem.org/Team:IISER-Tirupati_India"> |
HOME | HOME | ||
</a> | </a> | ||
</li> | </li> | ||
<li class="nav-item dropdown"> | <li class="nav-item dropdown"> | ||
− | <a class="nav-link dropdown-toggle" href="#" id="navbarDropdown" role="button" data-bs-toggle="dropdown" aria-expanded="false"> | + | <a class="nav-link active dropdown-toggle" href="#" id="navbarDropdown" role="button" data-bs-toggle="dropdown" aria-expanded="false"> |
PROJECT | PROJECT | ||
</a> | </a> | ||
<ul class="dropdown-menu dropdown-menu-end fade-down" aria-labelledby="navbarDropdown"> | <ul class="dropdown-menu dropdown-menu-end fade-down" aria-labelledby="navbarDropdown"> | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Description">DESCRIPTION</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Description">DESCRIPTION</a></li> | ||
− | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/ | + | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Blueprint">BLUEPRINT</a></li> |
− | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Engineering">ENGINEERING SUCCESS</a></li> | + | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Engineering">ENGINEERING SUCCESS </a></li> |
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Background">BACKGROUND</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Background">BACKGROUND</a></li> | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Implementation">IMPLEMENTATION</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Implementation">IMPLEMENTATION</a></li> | ||
Line 83: | Line 68: | ||
</a> | </a> | ||
<ul class="dropdown-menu fade-down" aria-labelledby="navbarDropdown"> | <ul class="dropdown-menu fade-down" aria-labelledby="navbarDropdown"> | ||
− | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/ | + | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Proof_Of_Concept">PROOF OF CONCEPT </a></li> |
− | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Design"> | + | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Design">DESIGN</a></li> |
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Parts">PARTS</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Parts">PARTS</a></li> | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Results">RESULTS</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Results">RESULTS</a></li> | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Safety">SAFETY</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Safety">SAFETY</a></li> | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Notebook">LAB NOTEBOOK</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Notebook">LAB NOTEBOOK</a></li> | ||
+ | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Excellence">EXCELLENCE</a></li> | ||
</ul> | </ul> | ||
</li> | </li> | ||
Line 108: | Line 94: | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Education">EDUCATION</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Education">EDUCATION</a></li> | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Communication">COMMUNICATION</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Communication">COMMUNICATION</a></li> | ||
− | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Inclusivity"> | + | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Inclusivity">INCLUSIVITY</a></li> |
− | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Sustainable">SUSTAINABLE DEVELOPMENT</a></li> | + | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Sustainable">SUSTAINABLE DEVELOPMENT </a></li> |
</ul> | </ul> | ||
</li> | </li> | ||
Line 116: | Line 102: | ||
TEAM | TEAM | ||
</a> | </a> | ||
− | <ul class="dropdown-menu fade-down" aria-labelledby="navbarDropdown"> | + | <ul class="dropdown-menu dropdown-menu-end fade-down" aria-labelledby="navbarDropdown"> |
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Team">MEMBERS</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Team">MEMBERS</a></li> | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Attributions">ATTRIBUTION</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Attributions">ATTRIBUTION</a></li> | ||
− | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Collaborations">COLLABORATIONS</a></li> | + | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Collaborations">COLLABORATIONS </a></li> |
<li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Partnership">PARTNERSHIP</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:IISER-Tirupati_India/Partnership">PARTNERSHIP</a></li> | ||
</ul> | </ul> | ||
Line 135: | Line 121: | ||
<div class="card" style=" max-width: 15.5rem; border: none !important;background-color:#FFBD59;" id="index"> | <div class="card" style=" max-width: 15.5rem; border: none !important;background-color:#FFBD59;" id="index"> | ||
<div class="card-body"> | <div class="card-body"> | ||
− | <h3 class="card-title text-center mb-3">INDEX</h3> | + | <h3 class="card-title text-center mb-3" style="color:#8d1063 !important">INDEX</h3> |
<section id="Index1"> | <section id="Index1"> | ||
− | <h5><a class="index_link" href="#1">New Parts From Literature</a></h5> | + | <h5><a class="index_link" href="#1" style="color:#8d1063 !important">New Parts From Literature</a></h5> |
<ul> | <ul> | ||
<li><a class="index_link" href="#11">Promoters</a></li> | <li><a class="index_link" href="#11">Promoters</a></li> | ||
Line 148: | Line 134: | ||
<section id="Index2"> | <section id="Index2"> | ||
− | <h5><a class="index_link" href="#2">Gene Gala</a></h5> | + | <h5><a class="index_link" style="color:#8d1063 !important" href="#2">Gene Gala</a></h5> |
</section> | </section> | ||
Line 154: | Line 140: | ||
</div> | </div> | ||
</div> | </div> | ||
− | + | ||
<div class="col-md-8 p-5"> | <div class="col-md-8 p-5"> | ||
<h2 id="1">New Parts from literature:</h2> | <h2 id="1">New Parts from literature:</h2> | ||
− | |||
− | |||
<h3 id="11">Promoters:</h3> | <h3 id="11">Promoters:</h3> | ||
<p>In order to achieve robustness in the system, it is necessary to have a library of promoters with a wide range of transcription rates. One such library of synthetic promoters from Liu et al. (2018) consisted of 214 synthetic promoters with consensus sequence as shown below <a style="color: #8d1063;" href="#ref5">[1]</a>:</p> | <p>In order to achieve robustness in the system, it is necessary to have a library of promoters with a wide range of transcription rates. One such library of synthetic promoters from Liu et al. (2018) consisted of 214 synthetic promoters with consensus sequence as shown below <a style="color: #8d1063;" href="#ref5">[1]</a>:</p> | ||
<div class="trable-responsive py-3" style="overflow-x: scroll;"> | <div class="trable-responsive py-3" style="overflow-x: scroll;"> | ||
− | <img src="./ | + | <img src="https://static.igem.org/mediawiki/2021/1/1a/T--IISER-Tirupati_India--SP_Backbone.jpg" alt="Trulli"> |
</div> | </div> | ||
<p class="text-center">Fig. 1 SP Backbone</p> | <p class="text-center">Fig. 1 SP Backbone</p> | ||
Line 169: | Line 153: | ||
<div class="table-responsive"> | <div class="table-responsive"> | ||
<table class="table table-striped"> | <table class="table table-striped"> | ||
− | + | <thead> | |
− | + | <tr> | |
− | + | <th> | |
− | + | <p>Promotor</p> | |
− | + | </th> | |
− | + | <th> | |
− | + | <p>Sequence 5‘ 3‘</p> | |
− | + | </th> | |
− | + | <th> | |
− | + | <p>Relative activity wrt<a href="http://parts.igem.org/Part:BBa_K143013"><strong> P43 </strong></a><strong>- GFP (%)</strong></p> | |
− | + | </th> | |
− | + | <th> | |
− | + | <p>Standard deviation</p> | |
− | + | </th> | |
− | + | </tr> | |
− | + | </thead> | |
− | + | <tbody> | |
− | + | <tr> | |
− | + | <td> | |
− | + | <p><a href="http://parts.igem.org/Part:BBa_K3889010">SP126</a></p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>AAAAATTATAAAAATGTGTTGACAAAGGGGGTCCTGTATGTTATAATAGCTT</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>29.07</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>0.23</p> | |
− | + | </td> | |
− | + | </tr> | |
− | + | <tr> | |
− | + | <td> | |
− | + | <p><a href="http://parts.igem.org/Part:BBa_K3889011">SP146</a></p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>AAAAATAACAAAAACGTGTTGACAATAAAGATTAACCGTGATATAATTAAAT</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>40.39</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>0.69</p> | |
− | + | </td> | |
− | + | </tr> | |
− | + | <tr> | |
− | + | <td> | |
− | + | <p><a href="http://parts.igem.org/Part:BBa_K3889012">SP200</a></p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>AAAAATTAGAAAAATGTGTTGACACTCGGACGAAACAATGGTATAATGGCAA</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>76.82</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>0.9</p> | |
− | + | </td> | |
− | + | </tr> | |
− | + | </tbody> | |
</table> | </table> | ||
</div> | </div> | ||
Line 238: | Line 222: | ||
<div class="table-responsive"> | <div class="table-responsive"> | ||
<table class="table table-striped"> | <table class="table table-striped"> | ||
− | + | <thead> | |
− | + | <tr> | |
− | + | <th> | |
− | + | <p>Part Name</p> | |
− | + | </th> | |
− | + | <th> | |
− | + | <p>Sequence</p> | |
− | + | </th> | |
− | + | <th> | |
− | + | <p>Rel KD</p> | |
− | + | </th> | |
− | + | <th> | |
− | + | <p>KD (in M)</p> | |
− | + | </th> | |
− | + | </tr> | |
− | + | </thead> | |
− | + | <tbody> | |
− | + | <tr> | |
− | + | <td> | |
− | + | <p><a href="http://parts.igem.org/Part:BBa_K3889080">P22 binding site A</a></p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>ATTTAAGATATCTTAAAT</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>1</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>1.6 × 10<sup>−8</sup></p> | |
− | + | </td> | |
− | + | </tr> | |
− | + | <tr> | |
− | + | <td> | |
− | + | <p><a href="http://parts.igem.org/Part:BBa_K3889081">P22 binding site B</a></p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>AATTAAGATATCTTAATT</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>1.8</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>2.88 × 10-8</p> | |
− | + | </td> | |
− | + | </tr> | |
− | + | <tr> | |
− | + | <td> | |
− | + | <p><a href="http://parts.igem.org/Part:BBa_K3889082">P22 binding site C</a></p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>ATTTAAGAATTCTTAAAT</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>2</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>3.2 × 10<sup>−8</sup></p> | |
− | + | </td> | |
− | + | </tr> | |
− | + | <tr> | |
− | + | <td> | |
− | + | <p><a href="http://parts.igem.org/Part:BBa_K3889083">P22 binding site D</a></p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>AGTTAAGATATCTTAACT</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>2.6</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>4.16 × 10<sup>−8</sup></p> | |
− | + | </td> | |
− | + | </tr> | |
− | + | <tr> | |
− | + | <td> | |
− | + | <p><a href="http://parts.igem.org/Part:BBa_K3889084">P22 binding site E</a></p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>ATTAAAGATATCTTTAAT</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>3.8</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>6.08 × 10<sup>−8</sup></p> | |
− | + | </td> | |
− | + | </tr> | |
− | + | <tr> | |
− | + | <td> | |
− | + | <p><a href="http://parts.igem.org/Part:BBa_K3889085">P22 binding site F</a></p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>ACTTAAGATATCTTAAGT</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>4.3</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>6.88 × 10<sup>−8</sup></p> | |
− | + | </td> | |
− | + | </tr> | |
− | + | <tr> | |
− | + | <td> | |
− | + | <p><a href="http://parts.igem.org/Part:BBa_K3889086">P22 binding site G</a></p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>ATTCAAGATATCTTGAAT</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>5</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>8.0 × 10<sup>−8</sup></p> | |
− | + | </td> | |
− | + | </tr> | |
− | + | <tr> | |
− | + | <td> | |
− | + | <p><a href="http://parts.igem.org/Part:BBa_K3889087">P22 binding site H</a></p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>ATTGAAGATATCTTCAAT</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>7.6</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>1.216 × 10<sup>−7</sup></p> | |
− | + | </td> | |
− | + | </tr> | |
− | + | <tr> | |
− | + | <td> | |
− | + | <p><a href="http://parts.igem.org/Part:BBa_K3889088">P22 binding site I</a></p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>ATTTAAGAGCTCTTAAAT</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>10</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>1.6 × 10<sup>−7</sup></p> | |
− | + | </td> | |
− | + | </tr> | |
− | + | <tr> | |
− | + | <td> | |
− | + | <p><a href="http://parts.igem.org/Part:BBa_K3889089">P22 binding site J</a></p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>ATTTAAGACGTCTTAAAT</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>10</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>1.6 × 10<sup>−7</sup></p> | |
− | + | </td> | |
− | + | </tr> | |
− | + | <tr> | |
− | + | <td> | |
− | + | <p><a href="http://parts.igem.org/Part:BBa_K3889090">P22 binding site K</a></p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>ATTTACGATATCGTAAAT</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>30</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>4.8 × 10<sup>−7</sup></p> | |
− | + | </td> | |
− | + | </tr> | |
− | + | <tr> | |
− | + | <td> | |
− | + | <p><a href="http://parts.igem.org/Part:BBa_K3889091">P22 binding site L</a></p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>ATTTAAAATATTTTAAAT</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>55</p> | |
− | + | </td> | |
− | + | <td> | |
− | + | <p>8.8 × 10<sup>−7</sup></p> | |
− | + | </td> | |
− | + | </tr> | |
− | + | </tbody> | |
</table> | </table> | ||
</div> | </div> | ||
Line 440: | Line 424: | ||
<p>Terminator checking device (<a href="http://parts.igem.org/BBa_K3889140">BBa_K3889140</a>): In order to check terminator efficiency a simple reference circuit was used similar to what used by Gale et al. (2021)<a style="color: #8d1063;" href="#ref5">[5]</a> as shown below:</p> | <p>Terminator checking device (<a href="http://parts.igem.org/BBa_K3889140">BBa_K3889140</a>): In order to check terminator efficiency a simple reference circuit was used similar to what used by Gale et al. (2021)<a style="color: #8d1063;" href="#ref5">[5]</a> as shown below:</p> | ||
<figure class="col-12 col-sm-10 col-md-8 m-auto"> | <figure class="col-12 col-sm-10 col-md-8 m-auto"> | ||
− | <img src="./ | + | <img src="https://static.igem.org/mediawiki/2021/6/63/T--IISER-Tirupati_India--contributiontermcheckdevice_01.jpg" alt="Trulli" style="width:100%"> |
<figcaption class="text-center p-3"> | <figcaption class="text-center p-3"> | ||
− | Fig.3 - Terminator Check Device | + | Fig.3 - Terminator Check Device |
</figcaption> | </figcaption> | ||
</figure> | </figure> | ||
+ | |||
<p>Now spacer can be replaced with any terminator in order to see the expression of sfGFP and mCherry.</p> | <p>Now spacer can be replaced with any terminator in order to see the expression of sfGFP and mCherry.</p> | ||
<figure class="col-12 col-sm-10 col-md-8 m-auto"> | <figure class="col-12 col-sm-10 col-md-8 m-auto"> | ||
− | <img src="./ | + | <img src="https://static.igem.org/mediawiki/2021/c/ca/T--IISER-Tirupati_India--contributiontermtobechecked_01.jpg" alt="Trulli" style="width:100%"> |
<figcaption class="text-center p-3"> | <figcaption class="text-center p-3"> | ||
Fig.4 - Terminator to be checked | Fig.4 - Terminator to be checked | ||
Line 454: | Line 439: | ||
</figure> | </figure> | ||
<div class="table-responsive"> | <div class="table-responsive"> | ||
− | + | <p>Formulae for terminator efficiency<a style="color: #8d1063;" href="#ref5">[5]</a></p> | |
− | + | ||
− | + | ||
− | + | <p>$TE_{Device}$ = $\frac{mCherry_{0}}{sfGFP_{0}}$</p> | |
− | + | <br> | |
− | + | <br> | |
− | + | where, | |
− | + | <br> | |
− | + | <p>$mCherry_{0} \rightarrow$ mCherry produced by device without terminator</p><br> | |
− | + | <p>$sfGFP_{0} \rightarrow$ sfGFP produced by device without terminator</p><br> | |
− | + | Using the device without any changes, $TE_{Device}$ can be calculated which gives the expression of <br>$mCherry$ in absence of a terminator.<br><br> | |
− | + | $TE=100-\left[\left(\frac{mCherry}{sfGPF}\right)\times\left(\frac{1}{TE_{Device}}\right)\times100\right]$ (2)<br><br> | |
− | + | where, <br><br> | |
+ | $mCherry$ $\rightarrow$ mCherry produced by device with the terminator that needs to checked<br><br> | ||
+ | $sfGFP$ $\rightarrow$ sfGFP produced by device with the terminator that needs to checked<br><br> | ||
</div> | </div> | ||
− | + | ||
− | + | ||
<h3 class="p-3" id="15">REFERENCES</h3> | <h3 class="p-3" id="15">REFERENCES</h3> | ||
Line 494: | Line 481: | ||
<p><strong>Zip File Name : Mini Summer school Resources -</strong><a href="https://drive.google.com/folderview?id=1LkMO9n0KYhkKXA8lggWYrLmLnC2MjK4c">https://drive.google.com/folderview?id=1LkMO9n0KYhkKXA8lggWYrLmLnC2MjK4c</a> </p> | <p><strong>Zip File Name : Mini Summer school Resources -</strong><a href="https://drive.google.com/folderview?id=1LkMO9n0KYhkKXA8lggWYrLmLnC2MjK4c">https://drive.google.com/folderview?id=1LkMO9n0KYhkKXA8lggWYrLmLnC2MjK4c</a> </p> | ||
− | <p>Note : It will be helpful if 2 people present the content, which will stop the lesson from becoming monotonous and keep students engaged.</p> | + | <p>Note : It will be helpful if 2 people present the content, which will stop the lesson from becoming monotonous and keep students engaged.</p> |
</div> | </div> | ||
</div> | </div> | ||
Line 501: | Line 488: | ||
</main> | </main> | ||
− | <section class="container-fluid" style="background-color: rgb(245, 245, 245);"> | + | |
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | |||
+ | <section class="container-fluid" style="background-color: rgb(245, 245, 245);"> | ||
<div class="container"> | <div class="container"> | ||
<div class="row align-items-center justify-content-center pt-5 half_border"> | <div class="row align-items-center justify-content-center pt-5 half_border"> | ||
<div class="col-8 col-md-2"> | <div class="col-8 col-md-2"> | ||
− | <img class="img" src="./ | + | <img class="img" src="https://static.igem.org/mediawiki/2021/0/0b/T--IISER-Tirupati_India--logo.svg" style="width: 100%;"> |
</div> | </div> | ||
<div class="col-8 col-md-3"> | <div class="col-8 col-md-3"> | ||
− | <img class="img igemiiser" src="./ | + | <img class="img igemiiser" src="https://static.igem.org/mediawiki/2021/e/e0/T--IISER-Tirupati_India--IgemIiser.svg" style="width: 100%;"> |
</div> | </div> | ||
<div class="col-12 col-md-6 offset-md-1"> | <div class="col-12 col-md-6 offset-md-1"> | ||
<h5 class="pt-3 text-center">Our Sponsors</h5> | <h5 class="pt-3 text-center">Our Sponsors</h5> | ||
− | <div class="row justify-content-center"> | + | <div class="row justify-content-center align-items-center pb-2"> |
− | <div class="col-3"><img class="img-fluid" src="./ | + | <div class="col-3"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/a/a3/T--IISER-Tirupati_India--IISERT.svg"></div> |
− | <div class="col-3"><img class="img-fluid" src="./ | + | <div class="col-3"><img class="img-fluid" style="padding:15px;" src="https://static.igem.org/mediawiki/2021/0/0b/T--IISER-Tirupati_India--GenScript.svg"></div> |
− | <div class="col-3"><img class="img-fluid" src="./ | + | <div class="col-3"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/6/6b/T--IISER-Tirupati_India--IDT.svg"></div> |
− | <div class="col-3"><img class="img-fluid" src="./ | + | <div class="col-3"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/0/0d/T--IISER-Tirupati_India--NEB.svg"></div> |
</div> | </div> | ||
<div class="row justify-content-center"> | <div class="row justify-content-center"> | ||
− | <div class="col-3"><img class="img-fluid" src="./ | + | <div class="col-3"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/7/76/T--IISER-Tirupati_India--Geneious.svg"></div> |
− | <div class="col-3"><img class="img-fluid" src="./ | + | <div class="col-3"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/9/99/T--IISER-Tirupati_India--Twist.svg"></div> |
− | <div class="col-3"><img class="img-fluid" src="./ | + | <div class="col-3"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/6/6b/T--IISER-Tirupati_India--Invideo.svg"></div> |
− | <div class="col-3"><img class="img-fluid" src="./ | + | <div class="col-3"><img class="img-fluid" src="https://static.igem.org/mediawiki/2021/0/06/T--IISER-Tirupati_India--Benchling.svg"></div> |
</div> | </div> | ||
</div> | </div> | ||
</div> | </div> | ||
<div class="row justify-content-center pt-3 pb-3"> | <div class="row justify-content-center pt-3 pb-3"> | ||
− | <div class=""> | + | <div class=""></div> |
<h5 class="text-center">Follow Us</h5> | <h5 class="text-center">Follow Us</h5> | ||
<div class="row"> | <div class="row"> | ||
Line 552: | Line 547: | ||
<div class="d-flex flex-column"> | <div class="d-flex flex-column"> | ||
<a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Description">DESCRIPTION</a> | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Description">DESCRIPTION</a> | ||
− | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Design"> | + | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Design">DESIGN</a> |
<a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Engineering">ENGINEERING</a> | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Engineering">ENGINEERING</a> | ||
<a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Background">BACKGROUND</a> | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Background">BACKGROUND</a> | ||
Line 562: | Line 557: | ||
<h6 class="quick_link_heading">WETLAB</h6>><br> | <h6 class="quick_link_heading">WETLAB</h6>><br> | ||
<div class="d-flex flex-column"> | <div class="d-flex flex-column"> | ||
− | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/ | + | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Proof_Of_Concept">PROOF OF CONCEPT</a> |
− | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Design"> | + | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Design">BLUEPRINT</a> |
<a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Parts">PARTS</a> | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Parts">PARTS</a> | ||
<a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Results">RESULTS</a> | <a class="quick_link" href="https://2021.igem.org/Team:IISER-Tirupati_India/Results">RESULTS</a> | ||
Line 600: | Line 595: | ||
</footer> | </footer> | ||
+ | <!-- Modal --> | ||
+ | <div class="modal fade" id="read1" tabindex="-1" aria-labelledby="exampleModalLabel" aria-hidden="true"> | ||
+ | <div class="modal-dialog modal-dialog-centered"> | ||
+ | <div class="modal-content"> | ||
+ | <div class="modal-header justify-content-center"> | ||
+ | <h5 class="modal-title text-center" id="exampleModalLabel">Side Effects of Current Methods of Contraceptives.</h5> | ||
+ | <button type="button" class="btn-close" data-bs-dismiss="modal" aria-label="Close"></button> | ||
+ | </div> | ||
+ | <div class="modal-body"> | ||
+ | <div class="row align-items-center"> | ||
+ | <div class="col"> | ||
+ | <ul> | ||
+ | <li>Cancers: Studies link a high risk of breast and cervical cancer for women taking oral contraceptive pills, while there is reduction in risks of endometrial, ovarian, and colorectal cancers.</li> | ||
+ | <li>Ovarian cysts: About 1 out of 10 women will get these fluid-filled sacs in their ovaries in the first year after they get an IUD. Cysts usually go away on their own within three months. </li> | ||
+ | <li>Cardiovascular diseases: A rise of 20-30% in arterial plaque was found in two big arteries for each decade of using birth control pills. For women who take a traditional combination pill with a low dose of estrogen, the risk of heart attack increases by 80% for them.</li> | ||
+ | <li>Depression: Use of hormonal contraception, especially among adolescents, was associated with subsequent use of antidepressants and the first diagnosis of depression, suggesting depression as a potential adverse effect of hormonal contraceptive use.</li> | ||
+ | <li>Migraines and headaches: In women who are not taking hormonal contraception, estrogen withdrawal during the late luteal phase is a well-recognized trigger of headaches and menstrual migraines</li> | ||
+ | </ul> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
</div> | </div> | ||
− | + | <script type="text/javascript" src="https://2021.igem.org/wiki/index.php?title=Template:IISER-Tirupati India/Bootstrap.js&action=raw&ctype=text/javascript"></script> | |
− | </ | + | <script type="text/javascript" src="https://2021.igem.org/wiki/index.php?title=Template:IISER-Tirupati India/js.js&action=raw&ctype=text/javascript"></script> |
− | + | <script type="text/javascript" src="https://2021.igem.org/wiki/index.php?title=Template:IISER-Tirupati India/AOS.js&action=raw&ctype=text/javascript"></script> | |
− | <script src="./ | + | <script type="text/javascript"> |
− | <script src="./ | + | AOS.init() |
− | <script> | + | |
− | + | ||
</script> | </script> | ||
− | |||
</html> | </html> |
Revision as of 09:07, 15 October 2021
New Parts from literature:
Promoters:
In order to achieve robustness in the system, it is necessary to have a library of promoters with a wide range of transcription rates. One such library of synthetic promoters from Liu et al. (2018) consisted of 214 synthetic promoters with consensus sequence as shown below [1]:
![Trulli](https://static.igem.org/mediawiki/2021/1/1a/T--IISER-Tirupati_India--SP_Backbone.jpg)
Fig. 1 SP Backbone
All these promoters are constitutive hence can be used for general protein production. From this library we used SP126, SP146 and SP200 having relative activity with respect to P43 as follows:
Promotor |
Sequence 5‘ 3‘ |
Relative activity wrt P43 - GFP (%) |
Standard deviation |
---|---|---|---|
AAAAATTATAAAAATGTGTTGACAAAGGGGGTCCTGTATGTTATAATAGCTT |
29.07 |
0.23 |
|
AAAAATAACAAAAACGTGTTGACAATAAAGATTAACCGTGATATAATTAAAT |
40.39 |
0.69 |
|
AAAAATTAGAAAAATGTGTTGACACTCGGACGAAACAATGGTATAATGGCAA |
76.82 |
0.9 |
P22 Operator Library:
P22 repressor (BBa_K3889020) binds to this sequence as a dimer. This inhibits the enzymes from transcripting the genes on whose promoter this operator site is fused with. Hence this could be used with any promoter in order to form a repressible system. Different binding affinities of a repressor provides a variable system that can be used for different expression levels of the target thereby enabling its in a variety of systems.Optimization and tweaking of a system can be done by varying the operator sites as well.
Part Name |
Sequence |
Rel KD |
KD (in M) |
---|---|---|---|
ATTTAAGATATCTTAAAT |
1 |
1.6 × 10−8 |
|
AATTAAGATATCTTAATT |
1.8 |
2.88 × 10-8 |
|
ATTTAAGAATTCTTAAAT |
2 |
3.2 × 10−8 |
|
AGTTAAGATATCTTAACT |
2.6 |
4.16 × 10−8 |
|
ATTAAAGATATCTTTAAT |
3.8 |
6.08 × 10−8 |
|
ACTTAAGATATCTTAAGT |
4.3 |
6.88 × 10−8 |
|
ATTCAAGATATCTTGAAT |
5 |
8.0 × 10−8 |
|
ATTGAAGATATCTTCAAT |
7.6 |
1.216 × 10−7 |
|
ATTTAAGAGCTCTTAAAT |
10 |
1.6 × 10−7 |
|
ATTTAAGACGTCTTAAAT |
10 |
1.6 × 10−7 |
|
ATTTACGATATCGTAAAT |
30 |
4.8 × 10−7 |
|
ATTTAAAATATTTTAAAT |
55 |
8.8 × 10−7 |
![Trulli](./assets/p22_binding_site.png)
Coding sequences:
SRTF1 or steroid responsive transcription factor 1 can negatively regulate any promoter activity with which it is fused with. SRTF1 binds to its binding site(BBa_K3889030) as done in BBa_K3889150. Presence of progesterone causes unbinding of SRTF thereby releasing it from the DNA, inducing the target gene.Thus,progesterone acts as an inducer and can be used in a progesterone inducible system by other teams as well.[4]
Device:
Terminator checking device (BBa_K3889140): In order to check terminator efficiency a simple reference circuit was used similar to what used by Gale et al. (2021)[5] as shown below:
![Trulli](https://static.igem.org/mediawiki/2021/6/63/T--IISER-Tirupati_India--contributiontermcheckdevice_01.jpg)
Now spacer can be replaced with any terminator in order to see the expression of sfGFP and mCherry.
![Trulli](https://static.igem.org/mediawiki/2021/c/ca/T--IISER-Tirupati_India--contributiontermtobechecked_01.jpg)
Formulae for terminator efficiency[5]
$TE_{Device}$ = $\frac{mCherry_{0}}{sfGFP_{0}}$
where,
$mCherry_{0} \rightarrow$ mCherry produced by device without terminator
$sfGFP_{0} \rightarrow$ sfGFP produced by device without terminator
Using the device without any changes, $TE_{Device}$ can be calculated which gives the expression of
$mCherry$ in absence of a terminator.
$TE=100-\left[\left(\frac{mCherry}{sfGPF}\right)\times\left(\frac{1}{TE_{Device}}\right)\times100\right]$ (2)
where,
$mCherry$ $\rightarrow$ mCherry produced by device with the terminator that needs to checked
$sfGFP$ $\rightarrow$ sfGFP produced by device with the terminator that needs to checked
REFERENCES
[1] Liu, D., Mao, Z., Guo, J., Wei, L., Ma, H., Tang, Y., Chen, T., Wang, Z., & Zhao, X. (2018). Construction, Model-Based Analysis, and Characterization of a Promoter Library for Fine-Tuned Gene Expression in Bacillus subtilis. ACS Synthetic Biology, 7(7), 1785–1797. https://doi.org/10.1021/acssynbio.8b00115
[2] Yang, S., Du, G., Chen, J., & Kang, Z. (2017). Characterization and application of endogenous phase-dependent promoters in Bacillus subtilis. Applied Microbiology and Biotechnology, 101(10), 4151–4161. https://doi.org/10.1007/s00253-017-8142-7
[3] Watkins, D., Hsiao, C., Woods, K. K., Koudelka, G. B., & Williams, L. D. (2008). P22 c2 Repressor−Operator Complex: Mechanisms of Direct and Indirect Readout. Biochemistry, 47(8), 2325–2338. https://doi.org/10.1021/bi701826f
[4] Baer, R. Cooper (2020). Discovery, characterization, and ligand specificity engineering of a novel bacterial transcription factor inducible by progesterone Boston University School of Medicine, 801 Massachusetts Avenue Suite 400 Boston, MA 02118 Retrieved from : https://hdl.handle.net/2144/41109
[5] Gale, G. A. R., Wang, B., & McCormick, A. J. (2021). Evaluation and Comparison of the Efficiency of Transcription Terminators in Different Cyanobacterial Species. Frontiers in Microbiology, 11. https://doi.org/10.3389/fmicb.2020.624011
Gene Gala
We held a Mini-Summer school in collaboration with the iGEM 2021 team of IISER Kolkata. It was a 5 day Mini-Summer School for Girl students studying in 12th Standards of the schools under the Directorate of Education, GNCT Delhi. As part of the summer school, the two teams together prepared a 5 day lesson plan, 2 quiz sessions and a day-to -day handbook made for reference for the students. We would like to present these resources as a contribution to iGEM.
Future iGEM teams can use them directly for conducting similar programmes in their regions/countries to the relevant audiences giving proper attributions to both the contributing teams. These resources will be extremely useful for teams who are preparing for similar education events. Conducting classes for 5 day enriched with activities and quiz sessions can be a daunting task for teams. The lesson plan provided here was able to keep the students engaged throughout the 5 days and it was easy for the team members to present as well. These content handbooks, lesson plans and quizzes will come in handy for future iGEM teams to prepare for such an event and take their public engagement to the next level.
The content is relevant for introducing high school seniors to Synthetic Biology, while giving them a holistic and application based view of the biology courses taught at the high school level.
Drive link to the handbook, quizzes and lesson plan -
Zip File Name : Mini Summer school Resources -https://drive.google.com/folderview?id=1LkMO9n0KYhkKXA8lggWYrLmLnC2MjK4c
Note : It will be helpful if 2 people present the content, which will stop the lesson from becoming monotonous and keep students engaged.