Difference between revisions of "Team:IISER-Tirupati India/Contribution"

Latest revision as of 05:56, 17 December 2021

Ovi-Cloak

SCROLL

INDEX

New Parts

Promoters
P22 Operator Library
Coding sequences
Device
Modifications in the old parts
References

The Handbook of Biotechnology Laws in India

New Parts:

Promoters:

In order to achieve robustness in the system, it is necessary to have a library of promoters with a wide range of transcription rates. One such library of synthetic promoters from Liu et al. (2018) consisted of 214 synthetic promoters with consensus sequence as shown below [1]:

Letter representation of SP backbone showing different regions.

Fig. 1 SP Backbone

All these promoters are constitutive hence can be used for general protein production. From this library we used SP126, SP146 and SP200 having relative activity with respect to P43 as follows:

Table 1. SP Promoters used

Promotor	Sequence 5' → 3'	Relative activity wrt P43- GFP (%)	Standard deviation
SP126	AAAAATTATAAAAATGTGTTGACAAAGGGGGTCCTGTATGTTATAATAGCTT	29.07	0.23
SP146	AAAAATAACAAAAACGTGTTGACAATAAAGATTAACCGTGATATAATTAAAT	40.39	0.69
SP200	AAAAATTAGAAAAATGTGTTGACACTCGGACGAAACAATGGTATAATGGCAA	76.82	0.9

P22 Operator Library:

P22 c2 repressor (BBa_K3889020, BBa_C0053) binds to the binding site (operator site) as a dimer. This inhibits the enzymes from transcribing the genes on whose promoter this operator site is fused. Hence this could be used with any promoter to form a repressible system. Different binding affinities of a repressor provide a variable system that can be used for different expression levels of the target, thereby enabling it in a variety of systems [2]. Optimization and tweaking of a system can be done by varying the operator sites as well.

Table 2. P22 binding sites and their Rel K_D and K_D

Part Name	Sequence	Rel K_D	K _D (in M)
P22 binding site A	ATTTAAGATATCTTAAAT	1	1.6 × 10⁻⁸
P22 binding site B	AATTAAGATATCTTAATT	1.8	2.88 × 10-8
P22 binding site C	ATTTAAGAATTCTTAAAT	2	3.2 × 10⁻⁸
P22 binding site D	AGTTAAGATATCTTAACT	2.6	4.16 × 10⁻⁸
P22 binding site E	ATTAAAGATATCTTTAAT	3.8	6.08 × 10⁻⁸
P22 binding site F	ACTTAAGATATCTTAAGT	4.3	6.88 × 10⁻⁸
P22 binding site G	ATTCAAGATATCTTGAAT	5	8.0 × 10⁻⁸
P22 binding site H	ATTGAAGATATCTTCAAT	7.6	1.216 × 10⁻⁷
P22 binding site I	ATTTAAGAGCTCTTAAAT	10	1.6 × 10⁻⁷
P22 binding site J	ATTTAAGACGTCTTAAAT	10	1.6 × 10⁻⁷
P22 binding site K	ATTTACGATATCGTAAAT	30	4.8 × 10⁻⁷
P22 binding site L	ATTTAAAATATTTTAAAT	55	8.8 × 10⁻⁷

Histogram showing the different values of K<sub>D</sub> values of different parts on the y-axis, there is rel K<sub>D</sub> and on the x-axis there is part number. — Fig.2 - K_D values of P22 binding site

Coding sequences:

SRTF1 or steroid responsive transcription factor 1 can negatively regulate any promoter activity if its binding site is fused with the gene's promoter. SRTF1 binds to its binding site(BBa_K3889030) as done in BBa_K3889150. Presence of progesterone causes unbinding of SRTF1 thereby releasing it from the DNA, inducing the target gene.Thus,progesterone acts as an inducer and can be used in a progesterone inducible system by other teams as well [3].

Device:

Terminator checking device (BBa_K3889140): In order to check terminator efficiency a simple reference circuit was used similar to what used by Gale et al. (2021) [4] as shown below:

Now, spacer can be replaced with any terminator to see the expression of sfGFP and mCherry.

Genetic circuit showing the terminator to be checked. — Fig.4 - Terminator to be checked

Formulae for terminator efficiency [4] :

\(TE_{Device} = \frac{mCherry_{0}}{sfGFP_{0}}\)

where,

\(mCherry_{0} \rightarrow\) mCherry produced by device without terminator

\(sfGFP_{0} \rightarrow\) sfGFP produced by device without terminator

Using the device/reference without any changes, \(TE_{Device}\) can be calculated which gives the expression of \(mCherry\) in absence of a terminator.

\begin{equation}\tag{2}TE=100-\left[\left(\frac{mCherry}{sfGPF}\right)\times\left(\frac{1}{TE_{Device}}\right)\times100\right]\end{equation}

where,
\(mCherry \rightarrow\) mCherry produced by device with the terminator that needs to checked

\(sfGFP \rightarrow\) sfGFP produced by device with the terminator that needs to checked

Modifications in the old parts:

Table 3.

Old part	New part	Name	Modifications made
BBa_K143036	BBa_K3889092	XylR	Removed Dual stop codons
BBa_C0053	BBa_K3889020	P22 c2 repressor	Removed Sap1 Recognition Site, LVA tag and Barcodes
BBa_K1442039	BBa_K3889069	P2A Peptide Linker PTV	BsmBI recognition site removed for Golden Gate compatibility
BBa_K3507002	BBa_K3889025	YqcG toxin	Mutated Xho1, HindIII and Bsa1 sites to make assembly compatible part
BBa_K3507003	BBa_K3889093	YqcF antitoxin	Mutated BgIII site
BBa_K143037	BBa_K3889026	YtvA	Mutated Bsa1 and HindIII Sites
BBa_K3519004	BBa_K3889027	bovine pancreatic DNase 1	Mutated HindIII Site
BBa_K2333011	BBa_K3889028	mf-Lon protease	Mutated multiple RE sites
BBa_I746916	BBa_K3889002	sfGFP	Mutated Kpn1 site and stop codon

REFERENCES

Liu, D., Mao, Z., Guo, J., Wei, L., Ma, H., Tang, Y., Chen, T., Wang, Z., & Zhao, X. (2018). Construction, Model-Based Analysis, and Characterization of a Promoter Library for Fine-Tuned Gene Expression in Bacillus subtilis. ACS Synthetic Biology, 7(7), 1785–1797. https://doi.org/10.1021/acssynbio.8b00115
Watkins, D., Hsiao, C., Woods, K. K., Koudelka, G. B., & Williams, L. D. (2008). P22 c2 Repressor− Operator Complex: Mechanisms of Direct and Indirect Readout. Biochemistry, 47(8), 2325–2338. https://doi.org/10.1021/bi701826f
Baer, R. Cooper (2020). Discovery, characterization, and ligand specificity engineering of a novel bacterial transcription factor inducible by progesterone Boston University School of Medicine, 801 Massachusetts Avenue Suite 400 Boston, MA 02118 Retrieved from: https://hdl.handle.net/2144/41109
Gale, G. A. R., Wang, B., & McCormick, A. J. (2021). Evaluation and Comparison of the Efficiency of Transcription Terminators in Different Cyanobacterial Species. Frontiers in Microbiology, 11. https://doi.org/10.3389/fmicb.2020.624011

Gene Gala

We held a Mini-Summer school in collaboration with the iGEM 2021 team of IISER Kolkata. It was a 5-day Mini-Summer School for Girl students studying in 12th Standards of the schools under the Directorate of Education, GNCT Delhi. As part of the summer school, the two teams together prepared a 5-days lesson plan, two quiz sessions, and a day-to-day handbook made for reference for the students. We would like to present these resources as a contribution to iGEM.

Future iGEM teams can use them directly for conducting similar programs in their regions/countries to the relevant audiences giving proper attributions to both the contributing teams. These resources will be extremely useful for teams who are preparing for similar education events. Conducting classes for five days enriched with activities and quiz sessions can be a daunting task for teams. The lesson plan provided here was able to keep the students engaged throughout the five days and it was easy for the team members to present as well. These content handbooks, lesson plans, and quizzes will come in handy for future iGEM teams to prepare for such an event and take their public engagement to the next level.

The content is relevant for introducing high school seniors to Synthetic Biology while giving them a holistic and application-based view of the biology courses taught at the high school level.