Team:MichiganState/Results

NavBar

Partnership Collaborations Communication
Human Practices Proposed Implementation Collaborations
Experiments Notebook Results Engineering Success
Description Contribution Model Bioinformatics Design
Team Attributions
Home
Results and Analysis

Results

While the broader experimental goals include multiple genetic interventions to restrict transfer of recombinant DNA (see Project Description), laboratory access was restricted due to COVID-related health considerations. We therefore focus our description of the experimentation of the Synterception project on the Conjugative Baseline Assay and Computational Results , as these were the best developed experimental goals during the time period.

Conjugative Baseline Assay

Evaluating the efficacy of interventions designed to reduce DNA transfer requires estimations of the rates of background transfer events. The experiments below were conducted to establish rates of DNA exchange from a donor to recipient cells and to estimate the likely mechanisms of transfer (e.g., conjugation, uptake of extracellular DNA, etc.)

In doing so, the following experimental groups consisted of liquid cultures of bacteria: donor control, E. coli WM3064, recipient control, E. coli C41, and a 1:1 ratio mixture of the donor and recipient strains.

Figure 1 Donor Control

Colonies counted on petri dish containing DAP

Dilution Fold t0 start t1 2 hours t2 5 hours
150000 31 70 29
125000 31 83 37
100000 39 89 55
75000 56 88 63
50000 65 95 84
25000 - - 95
Average 3.98 * 106 8.23 * 106 4.68 * 106
Standard Deviation 5.12 * 105 2.50 * 106 5.04 * 105

The Donor Control colonies consist of E. coli WM3064 (DAP auxotroph) containing GFP, a reporter acting as the gene of interest for the purpose of these Baseline assays. Cells were plated on appropriate selection plates in order to determine the basal rates of colony forming units (CFUs). These results were collected independent from the conjugative mixture data. The purpose of this trial was to quantify the colonies corresponding to the OD600 to better understand the donor strain’s presence in the conjugative mixture.

Figure 2 Recipient Control

Colonies counted on petri dish containing Ampicilllin

Dilution Fold t0 start t1 2 hours t2 5 hours
150000 37 47 60
125000 37 54 71
100000 46 83 89
75000 59 75 95
50000 - - -
25000 - - -
Average 4.08 * 106 6.93 * 106 8.48 * 106
Standard Deviation 5.08 * 105 1.10 * 106 9.02 * 105

Likewise, the recipient control group consisted only of the E. coli C41 strain with a selective marker. The colonies recorded along with the OD600 were used to equate the recipient strain grown in the conjugative mixture.

Figure 3 Conjugative Mixture

Colonies counted on petri dish containing DAP

Dilution Fold t0 start t1 2 hours t2 5 hours
150000 11 25 22
125000 13 31 27
100000 19 29 36
75000 22 42 52
50000 33 43 68
25000 57 - -
Average 1.64 * 106 3.23 * 106 3.49 * 106
Standard Deviation 1.25 * 104 7.87 * 105 2.74 * 105

The Conjugative Mixture colonies collected above, represent the total colonies (donor and recipient strains) from a liquid culture. The divided colonies are seen in Figure ### Ratio of Colonies. The colonies were split based on the control groups and OD600 from the corresponding strains and mixture data.

Figure 4 Transconjugant Colonies

Colonies counted on petri dish containing Ampicillin

Dilution Fold t0 start t1 2 hours t2 5 hours
10000 - - -
1000 - - -
500 - - -
100 9 40 36
50 - - -
25 - - -
Average 9.00 * 102 4.00 * 103 3.60 * 103

The Conjugative Mixture colonies collected above, represent the total colonies (donor and recipient strains) from a liquid culture. The divided colonies are seen in Figure ### Ratio of Colonies. The colonies were split based on the control groups and OD600 from the corresponding strains and mixture data.

Figure 5 OD600

Colonies counted on petri dish containing Ampicillin

Strain t0 start t1 2 hours t2 5 hours
Donor Control 0.960 1.20 1.35
Recipient Control 0.950 1.12 1.23
Conjugative Mixture 0.955 1.22 1.43

The OD600s from the corresponding colony data collection were recorded. The conjugative mixture received a 1:1 volume ratio of both the donor and recipient controls.

Multiple Sequence Alignment

With the use of bioinformatics techniques the team was able to perform a gene homology assessment on plasmids in the Incompatibility P family. Addressing primarily the homology of the TraI gene, which codes for the conjugative relaxase, an enzyme essential for the process of conjugation and DNA transfer. The catalytic center of the relaxase, Tyrosine 22 was discovered, and created a list of 10 sequences Cas9 could target to knock out the TraI gene at this catalytic tyrosine. Our consensus sequence is as follows:

AAGGATAATTACTATGTGCTGGG

Another 9 sequences have been arbitrarily selected from the same multiple sequence alignment from which the consensus sequence was derived. The nucleotide sequences are as follows:

AAAGACAATTACTACGTCATCGG AAGGATAATTACTACGTCATAGG AGGGATAACTACTACGTGCTGGG AAGGATAATTACTATGTACTGGG TCCGATAACTACTATTTTCTGGG AAGGATAATTACTATGTCTTGGG AAAGATAATTACTACGTCATCGG GAAGACAACTACTATGCCAGCGG AAGGATAATTACTACGTTATCGG

With this nucleotide region knocked out, the relaxase should cease to function. These sequences in the IncP conjugative plasmids play a crucial role in the functionality of the TraI gene.

The selected sequences were chosen arbitrarily from a dataset composed of 284 IncP plasmid sequences. Due to time constraints, a more rigorous selection process was not chosen to determine which 23 base pair sequences we would include as targets for Cas9.

Horizontal Gene Transfer Kinetics Model

Above, the plot is a result of a Python script using End-Point and Markov Method inspired modeling. The initialization of the script begins with two cells: one donor (pink) and one recipient (green). While the program calculates the states over time, the occurrences in conjugated cells (brown) and transconjugants (blue) change accordingly. As a tool for simulating the steady states for baseline conjugation occurring (respective to the Conjugative Baseline Assay), the slider pictured above the plot is adjustable in the program. The applied values on the slider correspond to the probability of transitioning cell states. Described below, the probabilities are defined by the mathematical and biological possibilities of transformation.

Analysis

The objective of the Conjugative Baseline Assay was to determine the rate of conjugation and transformation occurring from an approximate 1:1 ratio of donor to recipient cells.

Figure 6 Ratio of Colonies

Strain t0 start t1 2 hours t2 5 hours
Conjugative Mixture 1.64*106 3.23*106 3.49*106
Donor in Mix 8.26*105 1.59*106 1.65*106
Recipient in Mix 8.18*105 1.48*106 1.50*106
Calculated Sum (D+R) 1.64*106 3.07*106 3.15*106
Standard Error 0.00 7.95*104 1.17*105
Percent Error 0.00% 4.92% 9.79%

The following Recipient and Donor in Mix colonies were calculated using the colonies present in the respective controls and OD600. An adjustment ratio was used to isolate the relationship between the OD600 and the colony count from the control groups. The strain in the mix was determined by half the OD600 divided by the adjustment ratio; this provided ratios for transconjugants and each strain in the mix.

Figure 7 Ratio of Transconjugants

Figure 6 Ratio of Colonies

Strain t0 start t1 2 hours t2 5 hours
D:R Ratio 1.01 1.07 1.10
D:T Ratio 9.18*102 3.97*102 4.58*102
R:T Ratio 9.08*102 3.71*102 4.17*102
R:T Ratio 1.12*10-3 2.68*10-4 3.05*10-4

The ratios in the table above were used to describe the rates of conjugation (Donor to Transconjuant) and rates of transformation (Recipient to Transconjugant).



</html>