Team:MTU-CORK/Biology Design

Biology Design

Bioinformatics

The designing of parts was done primarily through the use of bioinformatic tools and online genetic and protein databases. The parts created were modelled from another iGEM team – Team Exeter 2018. The same parts were recreated and improved. All parts were sourced from Azospira suillum, formerly known as Dechloromonas suillum. The matching protein sequences were searched for using the RCSB protein databank (PDB). PDB produced results for partial sections of the perchlorate reductase genomic island. The protein responsible for producing chlorite dismutase (Cld) was available along with subunit PCRAB of the perchlorate reductase producing protein. The locus of these proteins was found in the genome of A. suilum using the Genbank, accession code: CP003153.1. This was done by using the online tool Backtranseq. The protein codes were back translated into nucleic acid sequences and aligned with the genome of the bacteria in order to find the correct locus and to confirm that the labels of the genes on the Genbank were correct. By identifying the correct correlating DNA sequences of these protein structure within the genome, the remaining genomic island was located and the PCRAB was separated into its subunits PCRA and PCRB. The locations found were as follows:

Sequence Locus
Cld Dsui_0145
PCRA Dsui_0149
PCRB Dsui_0148
PCRC Dsui_0147
PCRD Dsui_0146
Once all the sequences were located and configured in their nucleic acid format, the codons had to be optimised for genetic engineering. This was performed by using the IDT codon optimisation tool. The A. suillum bacteria is not as well known or studied as Escherichia coli so the decision was made to transfer the necessary coding into an E. coli bacterium. E. coli BL21 is stable, robust, safe and has a high production rate, all these attributes make it an ideal candidate for bioremediation. The E. coli would be given the genetic material necessary to become a perchlorate reducing bacteria via Gibson Assembly Cloning.

Primer Design

After the DNA sequences were isolated primers had to be designed in order to isolate the genes from the genome. A perfect primer pair was designed following primer guidelines and the flanking sequences were added onto the DNA sequences to be ordered.

Guidelines

  • 20 base pairs in length
  • GC clamp in last 5 bases on 3’ end
  • 50%-60% GC = 10-12 base pairs GC to keep the Tm within 55-65C
  • Avoid consecutive G’s and have no triplicates of C or G
  • Terminate with a GC base preceded by pyrimidine base
  • Terminate with a double purine GC clamp and avoid terminating with T
  • Avoid more than 2 purine bases in last 3’ bases
(ThermoFisher, 2019)

Forward Primer

Reverse Primer

Primer Flanks



AACCTGAGCCTGTGCTAACC————————GCTTTGGTGACGAACAGCAT


DNA Sequence



Sequence Assembly

After the codons were optimised and the primers were designed, the sequences had to be assembled via Benchling. Along with the primers and the gene, a secretion signal and a histag had to be added to the sequences. Some sequences were also given a green fluorescent protein (GFP). The order of these components was as follows:
  1. Forward Primer Flank
  2. Secretion Signal
  3. DNA
  4. GFP (optional)
  5. Histag
  6. Reverse Primer Flank
Annotations and colours were assigned to each assembly and the following linear graphics were produced:






Genetic Engineering

Gibson assembly cloning is the chosen technique for integrating the perchlorate reductase genomic island into E.coli Bl21. This method was chosen due to its many advantages such as not requiring a restriction site, few steps, single tube redaction, not leaving scars etc. A plasmid would be created with identical adjacent segments to our PCRABCD part. This step would be followed by a polymerase chain reaction (PCR) to ensure the correct result was yielded. The segments would be combined via a Gibson assembly reaction kit. The plasmid with the integrated DNA would then be transformed into our E. coli bacterium (Gibson, 2009).