Team:MIPT MSU/Experiments

project
DescriptionEngineering successModelProof of conceptImplementation
team
Team membersAttributionsCollaboration
human practices
Human practicesEducationExcellence in another areaBest Education
contribution
Partscontribution
lab work
Experiments and protocolsresults
Experiments

This protocol shows how we cloned Syncytin into Evrogen turboGFP N vector.

Materials:

  1. cDNA from MCF7 cell line or order Gene synthesis.

  2. Primers:

    F-syncytin - GGAAAGAATTCATGGCCCTCCCTTATCATATTTTTCTCT

    R-s-stop - AACCGGTCTAACTGCTTCCTGCTGAATTGGG

    R-s - AACCGGTAAACTGCTTCCTGCTGAATTGGG

    F-CMV - ATAAGCAGAGCTGGTTTAGT

    R-GFP - AACTCCACGCCGTT

  3. Taq, Q5 polymerase and buffers for them.
  4. Evrogen turboGFP N vector plasmid.
  5. Restriction: AgeI, EcoRI.
  6. Thermo Fisher FastDigest x10 buffer.
  7. T4 DNA ligase, 10x T4 ligation buffer.
  8. Competent cells (XL10 Gold).

Procedure:

  1. Syncytin PCR:

    Reagent Volume, μl PCR program
    2X MasterMix 10 1. 98 C → 30'' 29X:
    F-syncytin 1 2. 98 C → 15''
    R-s-stop/s 1 3. 60 C → 30''
    DNA 0.5 4. 72 C → 1'
    H2O 7.5 5. 72 C → 1'
    Total 20 6. 4 C → inf
  2. Gel electrophoresis, and use kit to purify DNA from gel.

  3. Restriction:

    Reagent Volume, μl Restriction condition
    FD 10x green buffer 1.5 2 hours at 37 С
    AgeI 0.5
    EcoRI 0.5
    Syncytin 10
    H2O 2.5
    Total 15
    Reagent Volume, μl Restriction condition
    FD 10x green buffer 1.5 2 hours at 37 С
    AgeI 0.5
    EcoRI 0.5
    Syncytin 0.5
    H2O 12
    Total 15
  4. Purify digested DNA from mixture.

  5. Ligation:

    Reagent Volume, μl Ligation condition
    10x T4 liogation buffer 1.5 Overnight at 16 C
    T4 ligase 0.5
    Syncytin 10
    TurboGFP N 3
    H2O 0
    Total 15
  6. Transformation (read more here)

  7. Screening colonies:

    Reagent Volume, μl PCR program
    5x screen mix 3 1. 95 C → 3' 29X:
    F 0.5 2. 95 C → 30''
    R 0.5 3. 54 C → 30''
    RNAse 0.1 4. 72 C → 1:45''
    H2O 11 5. 72 C → 5'
    Total 15 6. 12 C → inf
    DNA 0
  8. Growth positively screened colonies in LB overnight.
  9. Use Miniprep to obtain plasmid DNA.

  10. Confirm obtained DNA by using PCR:

    Reagent Volume, μl PCR program
    5x screen mix 3 1. 95 C → 3' 29X:
    F 0.5 2. 95 C → 30''
    R 0.5 3. 54 C → 30''
    H2O 10.5 4. 72 C → 1:45''
    DNA 0.5 5. 72 C → 5'
    Total 15 6. 12 C → inf

This protocol shows how we cloned LacZ into Evrogen turboGFP C vector.

Materials:

  1. LacZ plasmid from iGEM kit transformed into DH5alpha cells.

  2. Primers:

    F-lacZ - ATGCCTCGAGCAATGACCATGATTACGGATTCACTGGC

    R-lacZ - ATGCGGTACCCATTATTTTTGACACCAGACCAACTGG

  3. Evrogen Taq, NEB Q5 polymerase and buffers for them.
  4. Evrogen turboGFP C vector plasmid.
  5. Restrictions: XhoI, KpnI.
  6. Thermo Fisher FastDigest x10 buffer.
  7. T4 DNA ligase, 10x T4 ligation buffer.
  8. Competent cells (XL10 Gold).

Procedure:

  1. LacZ PCR:

    Reagent Volume, μl PCR program
    2X MasterMix 10 1. 98 C → 30'' 29X:
    F-lacZ 1 2. 98 C → 15''
    R-lacZ 1 3. 60 C → 30''
    DNA 0.5 4. 72 C → 1'
    H2O 7.5 5. 72 C → 1'
    Total 20 6. 4 C → inf
  2. Gel electrophoresis, and use Evrogen or Thermo Fisher kit to purify DNA from gel

  3. Restriction:

    Reagent Volume, μl Restriction condition
    FD 10x green buffer 1.5 2 hours at 37 С
    KpnI 0.5
    XhoI 0.5
    LacZ 10
    H2O 2.5
    Total 15
    Reagent Volume, μl Restriction condition
    FD 10x green buffer 1.5 2 hours at 37 С
    KpnI 0.5
    XhoI 0.5
    TurboGFP C 0.5
    H2O 12
    Total 15
  4. Purify digested DNA from mixture.

  5. Ligation:

    Reagent Volume, μl Ligation condition
    10x T4 liogation buffer 1.5 Overnight at 16 C
    T4 ligase 0.5
    LacZ 10
    TurboGFP C 3
    H2O 0
    Total 15
  6. Transformation (read more here)

  7. Screening colonies:

    Reagent Volume, μl PCR program
    5x screen mix 3 1. 95 C → 3' 29X:
    F-lacZ 0.5 2. 95 C → 30''
    R-lacZ 0.5 3. 60 C → 30''
    RNAse 0.1 4. 72 C → 1:45''
    H2O 11 5. 72 C → 5'
    Total 15 6. 12 C → inf
    DNA 0
  8. Growth positively screened colonies in LB overnight.
  9. Use Miniprep to obtain plasmid DNA.

  10. Confirm obtained DNA by using PCR:

    Reagent Volume, μl PCR program
    5x screen mix 3 1. 95 C → 3' 29X:
    F-lacZ 0.5 2. 95 C → 30''
    R-lacZ 0.5 3. 54 C → 30''
    H2O 10.5 4. 72 C → 1:45''
    DNA 0.5 5. 72 C → 5'
    Total 15 6. 12 C → inf

This protocol shows how we cloned gag into lentiviral vector.

Materials:

  1. Gag plasmid from Laboratory of Cell Signalling Regulation.

  2. Primers:

    F-gag - ATGCTCTAGAATGGGTGCGAGAGCGTC

    R-gag - ATGCGCGGCCGCTTATTGTGACGAGGGGTCGCTG

  3. Evrogen Taq polymerase and its buffer.
  4. Lentiviral vector plasmid.
  5. Restriction: XbaI, NotI.
  6. Thermo Fisher FastDigest x10 buffer.
  7. T4 DNA ligase, 10x T4 ligation buffer.
  8. Competent cells (XL10 Gold).

Procedure:

  1. Restriction:

    Reagent Volume, μl Restriction condition
    FD 10x green buffer 1.5 2 hours at 37 С
    NotI 0.5
    XbaI 0.5
    Gag 10
    H2O 2.5
    Total 15
    Reagent Volume, μl Restriction condition
    FD 10x green buffer 1.5 2 hours at 37 С
    NotI 0.5
    XbaI 0.5
    Vector 0.5
    H2O 12
    Total 15
  2. Purify digested DNA from mixture.

  3. Ligation:

    Reagent Volume, μl Ligation condition
    10x T4 liogation buffer 1.5 Overnight at 16 C
    T4 ligase 0.5
    Gag 10
    Vector 3
    H2O 0
    Total 15
  4. Transformation (read more here)

  5. Screening colonies:

    Reagent Volume, μl PCR program
    5x screen mix 3 1. 95 C → 3' 29X:
    F-gag 0.5 2. 95 C → 30''
    R-gag 0.5 3. 60 C → 30''
    RNAse 0.1 4. 72 C → 1:45''
    H2O 11 5. 72 C → 5'
    Total 15 6. 12 C → inf
    DNA 0
  6. Growth positively screened colonies in LB overnight.
  7. Use Miniprep to obtain plasmid DNA.

  8. Confirm obtained DNA by using PCR:

    Reagent Volume, μl PCR program
    5x screen mix 3 1. 95 C → 3' 29X:
    F-gag 0.5 2. 95 C → 30''
    R-gag 0.5 3. 60 C → 30''
    H2O 10.5 4. 72 C → 1:45''
    DNA 0.5 5. 72 C → 5'
    Total 15 6. 12 C → inf

Guidelines to transform E.coli XL-10 gold chemically competent cells.

Materials:

  1. Chemically competent Cells (100 μl.)
  2. Plasmid (around 100ng) or Ligation Mix.
  3. LB.

  4. Selective antibiotic:

    Amp

    Carb

    Kan

Procedure:

  1. Take competent cells out of -80°C and thaw on ice (approximately 20-30 mins).
  2. Add plasmid/ligation mix, gently mix with cells, leave for 20-30 minutes in ice.
  3. Heat-shock 30" at 42 С.
  4. Put the tubes back on ice for 2 min.
  5. In sterile conditions: add 500 ul LB to cells.
  6. Keep shaking incubator at 37 C for 30' (Amp/Carb) or 1 hour (Kan).
  7. In sterile conditions: Plate transformation onto 10 cm LB agar plate containing the appropriate antibiotic.
  8. Incubate plates at 37 C overnight.

We used standard Gibson Assembly Cloning Kit, with protocol E5510 (more information from NEB can be found here) to construct 5 plasmids:

5’ - psi(short) - IRES - GFP - lacZ -3’

5’ - psi(short) - GFP -lacZ - 3’

5’ - psi(long) - IRES -GFP - lacZ - 3’

5’ - psi(long) - GFP - lacZ -3’

5’ - IRES - GFP - lacZ - 3’

Primers used:

1,2-vec-R CGAGTCCTGCGTCGAGAGAGGACCGGTAGCGCTAGCG
1,2-psi(s)-F ATCCGCTAGCGCTACCGGTCCTCTCTCGACGCAGGACTCG
1-psi(s)-R CCACTGTTTAACGGTCTTCAGACGCTCTCGCACCCAT
1-IRES-F TGAAGACCGTTAAACAGTGGACGTTACTGGCCGAAGCC
1,3,5-IRES-R TCGTCGCTCTCCATGGTGGCTATTATCATCGTGTTTTTCAAAGGAAAACCACG
2-psi(s)-R CACTGTTTCCAACGGTCTTCAGACGCTCTCGCACCCAT
2-vec-F TGAAGACCGTTGGAAACAGTGGGTCGCCACCATGGAGAGC
3,4-vec-R CTGGTCTAACCAGAGAGACCGACCGGTAGCGCTAGC
3,4-vec-R CTGGTCTAACCAGAGAGACCGACCGGTAGCGCTAGC
3,4-psi(l)-F ATCCGCTAGCGCTACCGGTCGGTCTCTCTGGTTAGACCAGATCTGAG
3-psi(l)-R CCACTGTTTAACGGTCTTCATACTGACGCTCTCGCACCC
3-IRES-F TGAAGACCGTTAAACAGTGGACGTTACTGGCCGAAGCC
4-psi(l)-R CCAGGTGTTGCAAAGCTGGGATACTGACGCTCTCGCACCC
4-vec-F TCCCAGCTTTGCAACACCTGGGCCACCATGGAGAGCGAC
5-vec-R GCGGCTTCGGCCAGTAACGTGACCGGTAGCGCTAGCG
5-IRES-F ATCCGCTAGCGCTACCGGTCACGTTACTGGCCGAAGCC

Numbers: 1, 2, 3, 4, 5 are the number of constructions in which primers are used. Names: vec, psi(s), psi(l), IRES are target for Primers. Vec - vector, psi(s) - psi short, psi(l) - psi long. F/R stands for Forward/Reverse.

Fragment length: Vector DNA length:
IRES - 551 nt GFP + lacZ - 7754 nt
psi-long - 126 nt
psi-short - 356 nt

The required mass of fragments for all constructions, except 3rd, was calculated using the NEBioCalculator.

For the 3rd construction, we had to double the molecular weight to increase the chances of success.

Fragment mass, ng Fragment mass, ng
Psi-long 13.77 0.4
IRES 21.32 0.5
Linearized vector plasmid 75 0.6
Gibson Assembly Master Mix (2x) - 10
Deionized Water - 8.7
Total Volume (μl) 20

Then we transformed our chemically competent cell (XL10 gold).

Nucleofection and Vesicle treatment

We used Lonza 4D-NucleofectorTM X Unit(https://bioscience.lonza.com/lonza_bs/GB/en/Transfection/p/000000000000203685/4D-Nucleofector-X-Unit) with standard protocol(https://bioscience.lonza.com/lonza_bs/RU/en/download/product/asset/21792).

Nucleofection was performed on the MCF7 cell in a 6 well plate.

To the 5 of these wells 3 plasmids we added:

  1. Syncytin(with stop codon)
  2. gag-polyprotein

  3. one of the constructions obtained in a previous step

    5’ - psi(short) - IRES - GFP - lacZ -3’

    5’ - psi(short) - GFP -lacZ - 3’

    5’ - psi(long) - IRES -GFP - lacZ - 3’

    5’ - psi(long) - GFP - lacZ -3’

    5’ - IRES - GFP - lacZ - 3’).

  4. To the last well we added only control GFP plasmid from the kit.

Two days after nucleofection, when we observed the luminescence, we collected the supernatant containing vesicles from the wells and added it to the petri dishes with HT-29 cells (confluence 80%). Total of 5 petri dishes were used, each filled with a unique supernatant. After a single day of waiting we collected plates to observe the luminescence.