Team:IISER Berhampur/Proof Of Concept

iGEM IISER_Berhampur
Our animated logo is keeping you company until the page has loaded.
Skip to main content

Introduction

Our rapid molecular detection kit uses several bimolecular reactions and combines them into a novel approach for detecting the presence of TB and MDR-TB. All reactions are serially coupled by utilizing the end product of the previous reaction as a component in the next one.

Below in the Construction part; we have discussed how all the reactions can successfully be connected to amplify, detect, and report the existence of the mutation in the target DNA. We have provided only some preliminary evidence that our design of the method can work as anticipated. Following that, we have also designed the prototype for our kit and considered how it could be further optimized into a rapidly adaptable point-of-care diagnostic tool.



Design

Our detection mechanism consists of the following five steps:

  1. Extraction of Mycobacterium tuberculosis genomic DNA.
  2. Amplification of target DNA using LAMP and colorimetric detection.
  3. Conversion of the LAMP products into single-stranded DNA (ssDNA) by T7 exonuclease digestion.
  4. Cas14a-guide RNA complex and Fluorescence Quencher (FQ) pair mediated detection of mutations.
  5. Detection of Fluorescence using hardware.

1) Extraction of Mycobacterium tuberculosis genomic DNA:- We wanted to use non-invasive methods for the detection of TB and MDR-TB. So swab or sputum samples will be collected from the patients. After taking sputum samples, the bacteria present in the sample will be lysed, and DNA will be extracted. However, the amount of MTB is low in sputum specimens. To increase the sensitivity of our assay in the next step, the extracted DNA will be amplified.

2) Amplification of target DNA using LAMP and colorimetric detection: The DNA from a patient’s swab sample will initially be amplified by Loop-mediated Isothermal Amplification technique (LAMP). Amplifying the DNA in the sample will increase the sensitivity of the kit. The advantages of LAMP over conventional PCR are (1) its minimal setup (only a water/dry bath is required) and (2) a greater yield of amplified DNA. Our primers will target conservative regions of rpoB and katG genes of Mycobacterium tuberculosis. rpoB encodes ß (beta) subunit of RNA polymerase and katG catalase-peroxidase, respectively. If present, the rpoB and katG genes will be amplified and detected by a pH-dependent phenol red mediated colorimetric change, which will confirm the presence of TB in the sample.

3) Conversion of the LAMP products into single-stranded DNA (ssDNA) by T7 exonuclease digestion: Our next step is to convert the LAMP amplified DNA into single-stranded DNA so that Cas14-guide RNA complexes can detect it. We propose to use phosphorothioate primer sets for forwarding amplification in LAMP to get one strand in the amplified products with this modification leaving the other strand unmodified. The unmodified strand in the amplified products will be digested by T7 exonuclease to create single-stranded DNA.

4) Cas14a-guide RNA complex and Fluorescence Quencher (FQ) pair mediated detection of mutations: Mutations in rpoB confer resistance to rifampicin and are confined to an 81 bp region in the gene known as rifampicin resistance determining region (RRDR) where S450L is the deadliest and most widespread mutations across India. Similarly, a katG mutation of Ser315T confers high-level resistance to isoniazid. The presence of both these mutations in a single isolate of Mtb will highlight it as an MDR-TB, while the presence of either mutation makes it a monoresistant TB.
A set of multiple gRNAs, targeting wild type or specific mutants of MDR-TB, will be produced by in vitro transcription and will be added to purified Cas14a in separate tubes to form a Cas14a ribonucleoprotein (RNP) along with a single-stranded DNA reporter containing a Fluorescence-Quencher (FQ) pair. The presence of wild-type alleles or different mutations will result in perfect base-pairing of the respective guide RNAs with the target DNA leading to activation of cis and trans nuclease activity of Cas14. The trans activity of cas14a will cleave the reporter DNA resulting in fluorescence emission. On the other hand, if the mutation is not present, a mismatch will be produced between the gRNAs and target DNA which will not result in activation of Cas14a, and hence no fluorescence will be detected. Thus, the differential binding will help to detect different mutant forms of MDR-TB.

5) Detection of Fluorescence using hardware: Usually, a fluorescence detector is used to detect fluorescence, which requires a computer setup. To make the system simple and portable, we propose the analysis of fluorescence with a mobile phone camera in a compact device in our MDR-TB detection kit (it has been used for SARS-CoV-2). The image generated will be analyzed by a simple MATLAB program in this setup.


For more information, please refer to the Experiment section.



Construction

Extraction of Mycobacterium tuberculosis genomic DNA:

As biosafety is a very important aspect for any detection kit, for the proof of concept, instead of a TB patient sputum sample, we proceeded with BAC clones of rpoB and katG gene. These clones were a kind gift from Prof. Rajesh Gokhale, National Institute of Immunology, Delhi. Following inoculation in a liquid medium with chloramphenicol, we extracted the BAC plasmids containing both genes using the NEB Plasmid isolation kit (New England Biolabs). For the protocols, please refer to the “Experimentation” page. We checked the isolated plasmid by performing Agarose gel electrophoresis.

Amplification of target DNA using LAMP and colorimetric detection:

As we extract the DNA from the patient's sputum sample (a non-invasive method), the amount of DNA collected will be less. So to amplify the DNA, we are using Loop-mediated isothermal application (LAMP) reactions. We have designed the primers for the LAMP assay with one set of primers (FIP) having a phosphorothioate modification.

rpoB target sequence

5’GCCGGTGGAAACCGACGACATCGACCACTTCGGCAACCGCCGCCTGCGTACGGTCGGCGAGCTGATCCAAAACCAGATCCGGGTCGGCATGTCGCGGATGGAGCGGGTG GTCCGGGAGCGGATGACCACCCAGGACGTGGAGGCGATCACACCGCAGACGTTGATCAACATCCGGCCGGTGGTCGCCGCGATCAAGGAGTTCTTCGGCACCAGCCAGCTGAGC CAATTCATGGACCAGAACAACCCGCTGTCGGGGTTGACCCACAAGCGCCGACTGTCGGCGCTGGGGCCCGGCGGTCTGTCACGTGAGCGTGCCGGGCTGGAGGTCCGCGACGTG CACCCGTCGCACTACGGCCGGATGTGCCCGATCGAAACCCCTGAGGGGCCCAACATCGGTCTGATCGGCTCGCTGTCGGTGTACGCGCGGGTCAACCCGTTCGGGTTCATCGA 3’

LAMP Primers

The primers were designed using the NEB LAMP primer design tool. Following primers were selected for assay.

ID:44 dimer dG: -2.20

ID:12 dimer dG: -1.16

katG target sequence

5’GCCGATCTGGTCGGCCCCGAACCCGAGGCTGCTCCGCTGGAGCAGATGGGCTTGGGCTGGAAGAGCTCGTATGGCACCGGAACCGGTAAGGACGCGATCACCACCGGCATCGAGG TCGTATGGACGAACACCCCGACGAAATGGGACAACAGTTTCCTCGAGA TCCTGTACGGCTACGAGTGGGAGCTGACGAAGAGCCCTGCTGGCGCT 3’

LAMP Primers

The primers were designed using the NEB LAMP primer design tool. Following primers were selected for assay.

ID:1 dimer dG: -2.36

ID:35 dimer dG: -1.23

We ordered the LAMP Primers for our experiment, but unfortunately, we couldn't get them to date. Though we were unable to perform LAMP reactions in the lab, for optimization, we did some online LAMP reactions on the website eLAMP using our designed primers.
As our designed primers will only bind to TB-specific DNA sequences, the amplification will be successful if the sample contains MTB DNA. The amplification can be confirmed by pH-dependent phenol red mediated colorimetric change and thus we will be able to detect the presence of TB along with amplification.

Conversion of the LAMP products into single-stranded DNA (ssDNA)

by T7 exonuclease digestion:

As mentioned earlier, we have used one set of primers (FIP) with a phosphorothioate modification in LAMP primers. Amplification with these primers will result in LAMP amplicons containing one strand with a phosphorothioate modification. The addition of T7 exonuclease to this amplified DNA will digest the unmodified strand leaving the modified strand intact. This is because T7 exonuclease will cleave DNA from 5’ to 3’ end but will be inhibited at the phosphorothioate modification. The result of digestion with T7 exonuclease will be an ssDNA corresponding to rpoB and katG regions.

Cas14a-guide RNA complex and Fluorescence Quencher (FQ) pair

mediated detection of mutations:

As soon as we got the Cas14 plasmid from the Addgene ( pLBH545_Tet-Cas14a1 ), we inoculated the stab culture in the Luria-Bertani (LB) medium containing 34 µg/ml chloramphenicol. The cultures were grown overnight at 37℃ following which, the plasmid was isolated by NEB Monarch Plasmid Purification kit (New England Biolabs). We then transformed the Cas 14 Plasmid into E.coli BL21DE3 expression strain to express Cas14a protein. A single colony was picked and inoculated in an LB medium containing 34 µg/ml chloramphenicol and incubated at 37℃. Following growth, we made glycerol stocks of these cultures (50% glycerol+ 50% culture medium). We are currently in the process of protein expression and purification by Ni-NTA affinity resin. Due to covid restriction and late access to laboratories, we could not experimentally show the action of cas14a and fluorescence quencher pair. But from the literature survey and thorough analysis.

Schematic representation of the Cas 14a mediated trans cleavage of DNA probe upon formation of Cas14-gRNA complex.

Through these literature analyses, we proposed that our expressed Cas14a, along with our design guide RNA ( link for our designed guide RNA ), forms Cas14a-guide RNA complex and binds to the ssDNA, specific to rpoB and katG gene. This interaction will induce the conversion of the Cis conformation of Cas14a to the trans conformation of Cas14a. This trans conformation will eventually lead to the cleavage of ssRNA of fluorescence quencher pairs. The FQ pair is based on EGFP for fluorescence, and for that, we will be using DPA (Dipicryl amine or hexanitrodiphenylamine) as a quencher pair. So as soon as the cleavage happens, the EGFP and quencher interaction is lost, and fluorescence is emitted, which can be detected by our proposed hardware device

Detection of Fluorescence using hardware:

Our main idea is to detect fluorescence released from the FQ pair after being cleaved by Cas14a. We are planning to use EGFP for our project, as it is more efficient and widely used for such kinds of detection methods. For our current experiment, we are using venus YFP. As Venus YFP and EGFP share quite similar properties regarding emission (YFP: 520, EGFP: 509), excitation( YFP: 505 nm, EGFP: 488), thus results for YFP can quite be optimized for the EGFP.
As we know, for a general commercial setup, signal to noise ratio must be 1000 S/N (signal-to-noise ratio ) for the concentration of 0.4 micromoles. We tried to check whether our fluorescent protein of interest satisfies the above requirement for efficient detection through our laser. We used fluorometric analysis to check at which concentrationYFP showed a 1000 S/N ratio. We carried out one to 10 fold dilutions from 10 to 10^10 dilution in 10 respective vials and analyzed their fluorescence emission in fluorometry. We found that at 10^7 dilution, the signal to noise ratio is 1000 with the concentration of 0.4 micromolar ( as per our requirement ). As these results are also optimized for the EGFP, thus we can say that using that 0.4 micromolar of EGFP can give an efficient emission result in our kit.

Fig 1

Fig 2

Fig 3

In fig 1 and 2, we got 12 vials, with fluorescence on the y-axis and wavelength on the x-axis. The first graph has no venus YFP concentration, but it still showed some fluorescence; thus, that can be considered noise. Dividing the fluorescence of subsequent vials, we get the signal to noise ratio. For vial 7, we get the S/N of about 1000, which minimum parameter we require to detect fluorescence. In fig 3, the concentration in 7 vials; that's the minimum concentration we require for the best detection results.


For more information, please refer to the Results section.



Cost Estimation

To show how effective our project is in comparison to other existing MDR-TB testing kits like CB-NAAT, we did a comparative cost analysis of the two testing kits.
The total cost of our project is around $6.37, with our reagents costing about $0.7, which is about 10.7% of our total cost. The reagent is also a major factor in bringing our price down in comparison to CB-NAAT. The greatest contributor to the total price is the cost of Assembly and filling with 53.7%. The packing of cartilage is the cheapest element in our kit, which is 2.3%. This proves that our diagnostics kit affordable alternative to other preexisting MDR-TB testing kits.



Conclusion

We started our project with some basic modelling, we did epidemiological studies to find out the utility of our kit. We then did chemical enzyme kinetics to optimize our experiment using modelling. From the eLAMP, we checked our primer constructs for their amplification ability and their sensitivity.
For the Cas14a1, as per our proposal, and literature survey we can safely say that our designed guide RNA can form complexes with the Cas14a protein, (both are produced from our designed biobrick). This complex will be able to bind to our target genes. At the same time, it can activate the Cas14a1 which can then cleave the FQ pair leading to fluorescence emission.
In the hardware part, from the above data, we are able to conclude that venus YFP, is quite optimized to use in the commercial setup for fluorescence detection. As venus YFP results are quite optimized for the EGFP, thus we can safely conclude that EGFP can be used for fluorescence detection FQ paired based method.
The above cost analysis shows that our kit is quite cheap in comparison to other pre-existing MDR TB diagnostics, which proves that our testing kit can be a cheap and reliable alternative to the existing testing methods. We have attached below a workflow chart for the wetlab work performed to date and the future aspects of our Project.



Credits

    Biorender and Canva have been used to design some of the images and posters.

References

  1. An isothermal method for sensitive detection of Mycobacterium tuberculosis complexes using CRISPR/Cas12a cis- and trans-cleavage Haipo Xu, Xiaolong Zhang, Zhixiong Cai, Xiuqing Dong, Geng Chen, Zhenli Li, Liman Qiu, Lei He, Xiaolong Liu, Jingfeng Liu bioRxiv 2020.02.03.933101;https://doi.org/10.1101/2020.02.03.933101

  2. Ai JW, Zhou X, Xu T, et al. CRISPR-based rapid and ultra-sensitive diagnostic test for Mycobacterium tuberculosis. Emerg Microbes Infect. 2019;8(1):1361-1369.https://pubmed.ncbi.nlm.nih.gov/31522608/

  3. Chunyang Lyu, Hua Shi, Yali Cui, Mingyuan Li, Ziyi Yan, Lingyi Yan, Yongmei Jiang, CRISPR-based biosensing is prospective for rapid and sensitive diagnosis of pediatric tuberculosis https://doi.org/10.1016/j.ijid.2020.09.1428

  4. Amplification-free detection of SARS-CoV-2 with CRISPR-Cas13a and mobile phone microscopy, https://doi.org/10.1016/j.cell.2020.12.001

  5. https://blog.labsadvisor.com/genexpert-test-cost/
  6. https://indiacsr.in/dlf-foundation-installs-cb-naat-machine-installed-in-gurgaon/
  7. https://msfaccess.org/sites/default/files/2019-12/2018%20COGS%20analysis%20of%20Xpert%20MTB_RIF%20Ultra%20cartridges.pdf
  8. https://www.genscript.com/cas9-kits.html