Team:IISER Berhampur/Engineering

Modelling 2021

Our animated logo is keeping you company until the page has loaded.
Skip to main content

Introduction

Tb is caused by a rod-shaped bacteria called Mycobacterium tuberculosis. It is a human pathogen responsible for causing tuberculosis (TB) and it's a major health problem in India and all across the world. Antimicrobial resistance has risen as the next big threat to the healthcare system. MDR-TB, a drug-resistant variant of TB is also rising due to inadequate facilities for patients and unaffordable detection. Currently, the culture methods to detect MDR-TB are slow and the molecular detection methods are expensive and require expertise. In low-income countries like India, detection for MDR is unavailable in peripheral regions like in rural areas and is only available in far places from the towns. Economically challenged patients usually can't afford doctors’ advice of proper diagnosis and potentially spread MDR-TB. This unavailability of proper diagnostic tests often limits the diagnosis of patients to TB while being MDR-TB patients, resulting in late diagnosis. All this pointed us towards the need for a rapid, affordable, and accessible diagnostic kit for MDR-TB.

Research

Following the preliminary study, where we discovered the necessity for a new detection method for MDR-Tb. We began a literature review on the antagonist (MDR-TB) and current detection techniques. We divided the literature survey into 3 main parts. Understanding the disease, prevalence of the disease, and current strategies used for its detection.

  1. Understanding the disease:
    In this part, we found out that rpoB and katG genes of Mycobacterium tuberculosis encode for ß subunit of RNA polymerase and catalase-peroxidase respectively. Mutations in rpoB confer resistance to rifampicin and are confined to an 81 bp region in the gene known as the rifampicin resistance determining region (RRDR). Similarly, a katG mutation confers resistance to isoniazid. The presence of both these mutations in a single isolate of Mtb will highlight it as an MDR-TB while the presence of either mutation makes it a monoresistant TB. [3]
  2. Prevalence:
    After an extensive literature review, we found that S315T in katG and S450L in rpoB were found to be the deadliest and most widespread mutations respectively across India. This analysis was performed by reading a variety of publications focusing on MDR-TB mutation patterns in different regions (North and South) and states in which MDR-TB was highly prevalent [4]. We mostly analyzed collected data from these regions in terms of sample size, percentage of resistance, and the recovery rate in patients as well as on more recent publications. Along with studying the mutation patterns, we also analyzed the strains where these experiments were conducted[5]. The most common strain used in the laboratory we found was Mycobacterium tuberculosis H37Rv [6].
  3. Current strategies used for its detection:
    Studies in this section showed that current detection methods are divided into culture methods, phenotypic methods, and molecular methods. However, the culture methods to detect MDR-TB are slow and take time in weeks, and also have requirements of resources and skilled technicians. On the other hand, molecular detection cuts down on time to three to four hours but these methods are expensive and require expertise. This section also included working and applications of different diagnostic kits currently used in medicine. This helped us to come up with a prototype design.[7] [8] [9]

Design
Build
Test
Learn & Improve

Introduction

The goal was clear: To make a cheap, accessible, sensitive, and rapid diagnostic kit for MDR-TB detection. We started by finding out sensitive and cheaper alternatives to the current system and added them as modules in our detection kit.
The final design of our kit had 3 modules.

  1. LAMP amplification
  2. sgRNA and Cas14 complex
  3. Hardware component.

Each module was designed to fulfill a definite purpose to reach our goal.



LAMP

Loop-mediated Isothermal Amplification technique (LAMP) is an amplification method that amplifies DNA at a constant temperature. It is a novel nucleic acid amplification method that amplifies DNA with high specificity, efficiency, and rapidity. This technique has been used as a detection method to detect bacterial, parasitic, and viral pathogens. This method of amplification in our kit will replace the general PCR-based amplification. The advantages of LAMP over conventional PCR are (1) its minimal setup (only a water/dry bath is required) and (2) a greater yield of amplified DNA.
LAMP will serve three purposes in our kit:-

  1. it will help increase the sensitivity of the kit
  2. As it removes the need for a thermal cycle for amplification it will help decrease the cost.
  3. Phenol-mediated color change, if amplification happens, will also help to detect the presence of TB.


sgRNA and Cas14 complex

Cas14a1 belongs to a family of exceptionally compact RNA-guided nucleases which are about the size of 400-700 amino acids. It has a bilobed architecture with REC (recognition) and nuclease (NUC) lobes. The single guide RNA (sgRNA) has a scaffold region and guiding region. The sgRNA is an engineered version of natural guide RNA found in archaea and bacteria, which confers ease and flexibility to use with Cas14a1 nuclease due to its reduced size and enhanced activity. Also, it does not require a PAM (Protospacer Adjacent Motif) sequence for target recognition. Cas14a1 and sgRNA can readily form complexes. We wanted to use a cost-effective and highly sensitive tool for SNP genotyping in the Mycobacterium tuberculosis genome. The main reasons for exploiting this tool in project CODE M are:

  1. The miniature size of Cas14a1 will help to reduce the cost of production of the kit by decreasing the materials required for its synthesis as compared to other Cas proteins.
  2. Its high-fidelity SNP genotyping will make it fit for use in our kit for highly sensitive detection of MDR-TB.
  3. sgRNA can be easily customized by engineering the spacer sequence to effectively target complementary sequences from the katG and rpoB genes in the Mtb genome.


Hardware

A fluorometer is essential for the detection of fluorescence in our kit as the amount of fluorescence produced is very low and cannot be detected by the naked eye. But a fluorometer also requires a computer set up to operate and computer setups are not cheap nor is it accessible to remote locations and because of this in low-income countries like India it is not possible to have a fluorometer at the periphery level. Hardware components in our kit will include mobile phone microscopy. Mobile phone microscopy can be considered as a plausible alternative to a fluorometer as mobile phones are more accessible and easy to handle than computers.
Hardware will serve two purposes in our kit.

  1. It will help us make our kit more accessible and easy to handle as it will be a small compact device.
  2. It will also help to reduce the cost of our kit as phones are much cheaper than a fluorometer and a computer setup.

For a detailed description of each module go to proof of concept>>design

CODE M Constructs

From literature and countless brainstorming sessions, we finalized upon using Cas14a1 protein for detecting SNPs in the Mtb genome extracted from sputum samples. The miniature size and high-fidelity SNP genotyping made us choose this for our project.
As the Cas14a1 was never used in any iGEM project before, it was never a part of the iGEM Parts Registry. So, our team took the lead to introduce its coding sequence and several other relevant parts as BioBricks in the Parts Registry.

The first challenge that we encountered was the selection of highly specific single-guide RNAs (sgRNAs) to minimize the off-target effects. Secondly, was the presence of a few unwanted restriction sites in our sequences. We worked on these challenges as we designed our biobricks.

Proposed Constructs

Using various basic parts, we assembled them into the required constructs for our project. Check out the constructs in the table below:

Part Number Construct Part Number Standard Construct
BBa_K3982025 CODE M Construct C1 BBa_K3982026 CODE M Construct S1
BBa_K3982030 CODE M Construct C2 BBa_K3982038 CODE M Construct S2
BBa_K3982031 CODE M Construct C3 BBa_K3982039 CODE M Construct S3
BBa_K3982032 CODE M Construct C4 BBa_K3982040 CODE M Construct S4
BBa_K3982033 CODE M Construct C5 BBa_K3982041 CODE M Construct S5


Building Our BioBricks

  1. For our construct C1, we propose to clone Part BBa_K3982006 along with Tet repressor (TetR), Tet operator (TetO), overlapping tetR/tetA promoters, RBS and T7Te terminator in pSB1C3 backbone.
  2. For each construct C2, C3, C4, C5, we propose to insert each of our four CODE M sgRNA sequences in the Addgene Plasmid # 15030 for targeting wild-type and mutant variants of katG and rpoB genes in Mtb genome, thus building four different constructs. For this, we propose using PCR-based Site-directed mutagenesis (SDM) with mutagenic primers. We plan to use SDM instead of conventional restriction cloning to avoid the generation of any overhangs in our construct and it will allow us for the introduction of specifically designed sgRNA sequences.
  3. In addition to the above-mentioned constructs, we propose to build a series of standard constructs S1 - S2 for comparing and testing the efficiency of expression. The standard constructs consist of coding parts from the main constructs along with well-characterized T7 promoters, RBS, and T7Te terminator.
  4. We propose to transform all our constructs in E. coli DH5α cells and the expression system to be used will be BL21(DE3) Competent Cells. We choose to use these, as E. coli DH5α cells are versatile and widely used for transformation experiments whereas BL21(DE3) cells have highly efficient transcription machinery.

    Visit the BioBrick page for more information.


Building LAMP primers

We first attempted designing our primers manually however manual primer designing proved to be a challenging task. The utilization of software tools was a much more effective method that helped in making the process faster and increasing the likelihood of reaction success. After going through several software, we built our LAMP primers using the NEB LAMP primer Design tool (New England Biolabs) [10] since we found this to be more user-friendly. We also used it as a guide to select our primers. We designed six sets of primers for each gene FIP ( F2 + F1c), BIP (B2 + B1c), F3,B3 and LF and LB ( loop primers).

The primers for both katG and rpoB were chosen according to the below parameters.



The below set of primers are the ones we chose for the rpoB gene sequence. Our project mainly focuses on the S450L mutation pattern represented in green (TCG); however, we optimized our search by selecting primers flanking the 81bp mutation hotspot which also includes the other 3 highlighted codons. These are H445D, D435V, and L431P.

Sequence retrieved from NCBI for strain H37Rv (NCBI Reference Sequence: NC_000962.3)

Primer 1:-

5’Gccggtggaaaccgacgacatcgaccacttcggcaaccgccgcctgcgtacggtcggcgagctgatccaaaaccagatccgggtcggcatgtcgcggatggagcgggtggtccgggagcggatgaccacccaggacgtggaggcgatcaca
ccgcagacgttgatcaacatccggccggtggtcgccgcgatcaaggagttcttcggcaccagccagctgagccaattcatg
gaccagaacaacccgctgtcggggttgacccacaagcgccgactgtcggcgctggggcccggcggtctgtcacgtgagcgtgccgggctggaggtccgcgacgtgcacccgtcgcactacggccggatgtgcccgatcgaaacccct
gaggggcccaacatcggtctgatcggctcgctgtcggtgtacgcgcgggtcaacccgttcgggttcatcga 3’

3’Cggccacctttggctgctgtagctggtgaagccgttggcggcggacgcatgccagccgctcgactaggttttggtctaggcccagccgtacagcgcctacctcgcccacca
ggccctcgcctactggtgggtcctgcacctccgctagtgtggcgtctgcaactagttgtaggccggccaccagcggcgctagttcctcaagaagccgtggtcggtcgactcggttaagtacctggtcttgttgggcgacagccccaactgggtg
ttcgcggctgacagccgcgaccccgggccgccagacagtgcactcgcacggcccgacctccaggcgctgcacgtgggcagcgtgatgccggcctacacgggctagctttggggactcccc
gggttgtagccagactagccgagcgacagccacatgcgcgcccagttgggcaagcccaagtagct 5’



Dimer dG: -2.20 (required oligos are orange)

F3:

CCGCAGACGTTGATCAACAT


B3:

CCCCTCAGGGGTTTCGA

FIP:

CAGCGGGTTGTTCTGGTCCATG GTCGCCGCGATCAAGG

BIP:

CCGGCGGTCTGTCACGTGA AGTGCGACGGGTGCA

F2:GTCGCCGCGATCAAGG

F1c:CAGCGGGTTGTTCTGGTCCATG

B2:AGTGCGACGGGTGCA

B1c:CCGGCGGTCTGTCACGTGA

Dimer dG: -1.66 (required oligos are orange)

LF:

AGCTGGCTGGTGCCGAA

For the same parameters, we obtained multiple sets of primers which we further selected based on a less negative delta G for dimer formation and primer sequences that flanked the target region more uniformly. Unfortunately, there were no loop primers available for the backward reaction.

In a similar manner, primers were also selected for the katG sequence. In katG we mainly focused on the S315T mutation pattern and likewise chose a primer set flanking this mutation. The katG sequence does not have any mutation hotspot region. The parameters considered were similar to those of rpoB primers.

Sequence retrieved from NCBI for strain H37Rv (NCBI Reference Sequence: NC_000962.3)

Primer 2:-

5’GCCGATCTGGTCGGCCCCGAACCCGAGGCTGCTCCGCTGGAGCAGATGGGCTTGGGCTGGAAGAGCTCGT
ATGGCACCGGAACCGGTAAGGACGCGATCACCACCGGCATCGAGGTCGTATGGACGAACACCCCGACGAA
ATGGGACAACAGTTTCCTCGAGATCCTGTACGGCTACGAGTGGGAGCTGACGAAGAGCCCTGCTGGCGCT 3’

Dimer dG: -2.36 (required oligos in orange)

F3:

AGGCTGCTCCGCTGGA

B3:

AGCAGGGCTCTTCGTCAG

FIP:

GGTGATCGCGTCCTTACCGGTGCAGATGGGCTTGGGC


BIP:

ACCGGCATCGAGGTCGTATGGCACTCGTAGCCGTACAGGAT


F2:GCAGATGGGCTTGGGC

F1c:GGTGATCGCGTCCTTACCGGT

B2:CACTCGTAGCCGTACAGGAT

B1c:ACCGGCATCGAGGTCGTATGG

Dimer dG: -1.23 (required oligos in orange)

LF:

GCCATACGAGCTCTTCCA

LB:

CGACGAAATGGGACAACAG



Building sgRNA

sgRNAs targeting LAMP amplified ssDNA sequences from Mtb will be generated by in vitro transcription using the plasmid vector https://www.addgene.org/15030/. The sgRNA sequence containing the crRNA (CRISPR RNA) and trRNA (Tracer RNA) was obtained from Harrington et al. (Harrington et al., 2018) and Kim et al. (Kim et al. 2021)

5’CTTCACTGATAAAGTGGAGAACCGCTTCACCAAAAGCTGTCCCTTAGGGGATTAGAACTTGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGTCGAGAAGTGCTTTCTT
CGGAAAGTAACCCTCGAAACAAATTCATTTTTCCTCTCCAATTCTGCACAAGAAAGTTGCAGAACCCGAATAGACGAATGAAGGAATGCAACNNNNNNNNNNNNNNNNNNNN3’


The last stretch of N nucleotides is gene and mutation-specific and the corresponding 20 nucleotide sgRNA sequences to be used in the study are shown below:

S.No Gene Mutation Sequence
1 rpob Wild Type CGCCGACTGTCGGCGCTGGG
2 rpob S450L CGCCGACTGTTGGCGCTGGG
3 katG Wild Type GCGATCACCAGCGGCATCGA
4 katG S315T GCGATCACCACCGGCATCGA

DNA gblocks encoding these sgRNAs with flanking BglII overhangs are assembled and have been ordered from IDT technologies, who are supporting iGEM teams by providing free oligos and DNA fragments. Following receipt of these fragments, they will be cloned in pSP64T plasmid (https://www.addgene.org/15030/). The plasmids will then be used for RNA synthesis (sgRNA) by using the SP6 Hiscribe RNA synthesis kit from NEB (New England Biolabs). The in vitro transcribed RNA will be purified and precipitated and used for hybridization.


Building hardware components

Our hardware component was inspired by the Fozouni et al. (Fozouni et al., 2021) kit for the detection of COVID-19[13]. To detect fluorescence with the highest efficiency. We planned to use a low-powered laser, with a wavelength range between 480 nm to 500 nm, a mirror, an aperture, an interference filter, a sample chamber, and a mobile phone. The laser will act as a light source to illuminate the sample chamber so that fluorescence can be produced. Mirrors and the aperture will help us to adjust the intensity of light and help the light to fall uniformly on the sample chamber. The interference filter will filter out non-essential light (noise) to take up the maximum signal. The sample chamber will be a chip containing space where mutation detection and fluorescence production will happen. The mobile phone will be an actual detector detecting the presence of fluorescence. The mobile phone will take multiple images and calculate the pixels present in the image and then average them out to give an output which is the presence or absence of fluorescence.



Testing LAMP primers

  1. BLAST
  2. eLAMP
  3. Wetlab experiment with LAMP

BLAST

In this step, we analyze the accuracy of our NEB-generated primers for this we performed BLAST. Basic Local Alignment Search Tool (BLAST) finds regions of similarity between sequences. It is an algorithm for comparing primary biological sequences like the nucleotides of DNA and/or RNA. We checked the accuracy by measuring the off-target effects in different organisms by performing a BLAST nucleotide search for all 11 primers (rpoB and katG) and limiting the search to 1000 sequences.


eLAMP

eLAMP is a free PERL script that electronically simulates Loop-mediated isothermal AMPlification(LAMP). It is a fast and inexpensive test of LAMP primer suitability. It helps to electronically simulate amplification ability and the sensitivity of primers. The graphical user interface (GUI) is simple which allows non-specialists users to easily use it, also the command-line interface is suitable for use in pipelines. Results are presented either in a single .csv file or in a GUI panel and they are straightforward to interpret. [11]

Go to experimentation for eLAMP Experimentation>>eLAMP.


LAMP sensitivity test (optimization)

The WarmStart Colorimetric LAMP 2X Master Mix is a mixture of Warmstart DNA Polymerase and WarmStart RTx it is a special low-buffer reaction solution having a visible pH indicator for rapid and easy detection of Loop-Mediated Isothermal Amplification (LAMP). Detection of amplification is shown by producing a change in solution color from pink to yellow. This happens due to the production of protons and subsequent drop in pH that occurs due to the extensive DNA polymerase activity in a LAMP reaction.
This system is designed to provide a fast, clear visual detection of amplification. This mix is easy to handle and efficient as it needs only a heated chamber and samples, it also provides readouts of positive amplification in 15–40 minutes which is easy to judge by eyes. [12] WarmStart Colorimetric LAMP 2X Master Mix Typical LAMP Protocol (M1800) was ordered for our kit. But due to COVID restrictions, they didn't arrive on time.

To check the sensitivity of our LAMP assay amount of target DNA will be taken at different concentrations and LAMP assay can be done for each concentration. The presence of phenol-mediated color change will show us that amplification has occurred. In this way, we can find out the minimum amount of Target DNA required for our LAMP assay to function. In our case for proof of principle study, the target DNA is present in the form of BAC clones. So after isolating the BAC clones from the bacteria and measuring the amount of DNA isolated a 1000 fold dilution can be done for the acquired DNA and then LAMP can be performed to check for sensitivity. The minimum concentration of target DNA at which LAMP occurs will help us in the optimization of the LAMP assay.



Testing sgRNA + Cas14


BLAST

For preliminary testing to assess the activity of the Cas14a1-sgRNA complex, we ran a BLAST of the spacer sequences. This enables us to find similar or identical sequences in the database for katG and rpoB sequences. A BLAST search was performed with a limit of 1000 organisms to find off-target organisms for both genes. Check the Results page to know more about this.


Optimization:- (using varying FQ concentration)

As the readout of a perfect hybridization of ssDNA and sgRNA is Cas14a1 mediated trans cleavage of a Fluorescent-Quencher containing DNA probe, we plan to optimize the concentration of DNA probe to get a good signal to noise ratio. We can test sgRNA and Cas14 activity at varying concentrations of FQ pairs. The reaction could be monitored on a plate reader and fluorescence measurements can be taken depending on the fluorophore used. Towards this end, we used a pure recombinant fluorescent protein (Venus) and found that a signal-to-noise threshold of 1000 could be reached at a concentration of 0.4µmoles.
Go to results section


Testing Hardware

From preliminary analysis, we were able to find out the minimum concentration required for the fluorescence signal of Venus, which was available in our labs at that time. We used a Commercial plate reader (Spectramax ID5) for our analysis. However, for our final design, we will be using Green Fluorescent Protein “EGFP” that shows fluorescence in the 480 nm - 500 nm range (peak at 488 nm). Using the concentration obtained from preliminary analysis, which is 0.4 micro Molar or 40picoMoles giving a signal/noise ratio of 1000, we planned to test it in the proposed model using EGFP. Unfortunately, due to the pandemic, we were unable to access labs and carry out the testing. But we were expecting positive results even with Green Fluorescent Protein “EGFP”, similar to the preliminary analysis done using the YFP. However, if we wouldn't be able to get the desired results, we would have re-done the experiments by either increasing the laser's power while taking necessary precautions or the concentration of the GFP.
Go to results section for YFP venus results

Learn Section

LAMP

  • 1. Learning from Primers BLAST


    The BLAST result for F3 rpoB, B3 katG, B3 rpoB, LB katG showed minimum off-targets i.e., 174 for F3 rpoB, 164 for B3 katG, 146 for B3 rpoB, and 129 for LB katG. However, off-targets for F3 katG and LF rpoB were substantially higher i.e., 530 and 812 respectively. For Mycobacterium tuberculosis, we found that the LAMP primers were specific to our target gene. When we analyzed the off-targets containing other organisms, we found that most of them were not human pathogens. We ruled them out as the likelihood of them being present in a human sputum sample was extremely low. Also, we ruled out some pathogens that were targeted by only 1 LAMP primer, as for the amplification to occur multiple primers are required. The remaining sequences showed an output of “no significant similarity found”.

    We also went deeper into our analysis to find the common human pathogen off-targets across all the BLAST searches. The below table summarizes it.
    .
    Off-target organism Pathogenesis Analysis
    Mycobacterium tuberculosis
    variant Bovis    		 Can cause TB in humans Part of the tuberculosis complex.
    Treatment is similar to normal TB.
    Mycobacterium tuberculosis
    variant microti     		Microti can cause severe pulmonary TB
    in immunocompetent patients however it
    mostly harms animals     		Part of the tuberculosis complex.
    Treatment is similar to normal TB.
    Mycobacterium tuberculosis
    variant africanum    		 Can cause TB Part of the tuberculosis complex.
    Treatment is similar to normal TB.
    Salmonella enterica CODE M sgRNA for targeting wildtype katG
    gene in Mycobacterium tuberculosis    		 Usually found in the intestine. The chances
    of being in the sputum sample are negligible.
    Pseudomonas aeruginosa Can cause pneumonia Potential misdiagnosis
    Pseudomonas Can cause multiple infections
    Eg-endophthalmitis, pneumonia, etc.    		 Potential misdiagnosis
    Chryseobacterium Can cause multiple infections Eg - myositis,
    keratitis, pneumonia, etc.
    It is also intrinsically multi-drug resistant     		Potential misdiagnosis
    (rare disease)
    Aspergillus brunneoviolaceus Can cause serious illnesses when people with
    weakened immune systems, underlying lung disease,
    or asthma inhale their fungal spores.    		 Potential misdiagnosis if not combined
    with preliminary testing like
    X-Ray/CT scan.

    In this list, the tuberculosis complex group causes pulmonary tuberculosis and has the same treatment regimen as normal TB. For other organisms that can be potentially misdiagnosed as TB by our device can be ruled out in the next step of SNP detection by Cas14. If the cas14 does not recognize the product either as wild type, rifampicin-resistant, or isoniazid-resistant we can send the sample for further testing.

  • 2. Learning from e-LAMP


    As eLAMP electronically simulates the isothermal amplification. The results obtained from eLAMP will tell us if primers made by us will work or not. It will also tell us about the amplification ability of our LAMP primers. The sensitivity of our LAMP primers will also be simulated in the eLAMP. eLAMP also provides the exact number of mismatches in our LAMP primers. However, eLAMP is limited to primers made on LAVA and Primer explorer as our primers were made with NEB LAMP Primer Design Tool it did not show proper results for us.

  • 3. Learning from LAMP sensitivity test(optimization)


    This test when performed will give us the minimum amount of target DNA required for amplification using the LAMP kit. This will help us to optimize the amount of LAMP reagents needed and the amount of bacterial DNA needed from patient samples. To get some more insights into this section we modeled it by making an enzyme kinetics model.
    Modelling Page



    • Learning from sg RNA+ Cas14

    • 1. BLAST


      The BLAST analysis will give an idea of the potential mismatches that might arise as a result of non-specific hybridization. The majority of the BLAST results were Mycobacterium tuberculosis. When we analyzed these off-targets, we found that most of them were not human pathogens. We ruled these out as the likelihood of them being present in a human sputum sample was extremely low. The BLAST search recorded a total of 455 organisms for katG wild-type sgRNA and 250 organisms for rpoB wild-type sgRNA.
      The organisms which could give us a false positive result are listed below
      Off-target organism Pathogenesis Analysis
      Mycobacterium canettii Can cause TB in humans Novel pathogenic taxon of
      the Mycobacterium tuberculosis
      complex
      Mycobacterium bovis Can cause TB in humans Part of the tuberculosis complex.
      Treatment is similar to normal TB.
      Pseudomonas Can cause multiple infections
      Eg-endophthalmitis, pneumonia, etc      		 Potential misdiagnosis
      Mycobacterium tuberculosis
      variant africanum      		 Part of the tuberculosis complex.
      Treatment is similar to normal TB.

    • 2. Optimization:- (using varying FQ concentration)


      This will give us an idea of how much probe concentration to use to detect a particular sequence type in the sample with a good signal-to-noise ratio. This result will also help us to optimize the probe concentrations to their minimum. So that the reaction can be performed at a minimum concentration of reagents.
      Modelling Page


    • 3. Learning from Hardware:


      Producing desirable results from experiments can help us prove the validity of our prototype. We will then have to focus on improving our working model. Since a lot of manual pre-processing (like vortexing, centrifuge, isolation, and transfer of reagents and products) is required even before the role of hardware comes into play, we thought of proposing an automated hardware device. This device will be handy and only require the user to load the sputum sample to test for TB/MDR-TB.




Improve Section


Optimizing Cas14-sgRNAs activity

  1. Potential challenge: Occurrence of unwanted off-target effects and less efficiency of Cas14a1-sgRNA complex.
  2. Solution: Though unintended off-target effects are rare for Cas14a1, in case we detect any off-target sites, we can analyze them using targeted deep sequencing. Also, we propose to use varying concentrations of Cas14a1 and sgRNA complex in our experiments to check its efficiency.

Further improvement in our kit:

  1. Potential challenge: Detection of other pathogens using this kit.
  2. Solution: This kit can be repurposed for the detection of other deadly pathogens too. To do this a few modules will need to be altered. Firstly LAMP primers will need to be altered in a way that they amplify the conserved region of the other pathogen. Visible readout of amplification by the phenol-mediated color change will confirm the presence of the pathogen. Furthermore, if resistance to antibiotics happens due to mutation in certain regions, guide RNAs specific to that mutation can also be created, this step can also be done for wild-type sequences for detection.

Hardware

Design: The automated design consists of three chambers - the pre-processing chamber, the lamp chamber, and the detection chamber. The device will be governed by software, and the user will have to set up the time for each step manually. The user will have to insert a test tube consisting of the sputum sample and glass beads into the pre-processing chamber of the proposed model. The test tube will sit on a vortex that will run for a set time and complete the lysis. A suction tube will then suck the sample to another test tube sitting on a centrifuge machine to isolate MTB DNA. After the centrifugation is completed, another suction tube will suck the supernatant from the test tube into the LAMP chamber, leaving behind the pellet. The LAMP chamber is a beaker inside a water bath already loaded with the LAMP primers and LAMP reagents, with a transparent screen on the top to observe what is going on inside.
Once the sample is added to the LAMP Chamber, the water bath starts heating up to a temperature of 65 Degrees Celsius, and the reaction continues for a set amount of time. After the reaction is completed, the device stops. The user will then have to observe a color change from the transparent screen. The color change indicates the presence of TB, and then the user will have to check the detection of MDR-TB strains. For this, the user will turn on a switch, telling the machine to go for MDR-TB detection. The suction tube will then suck the sample in the LAMP chamber and transfer it into the detection chip (detection chamber). If the user observes no change in color, the testing stops. No color change indicates that the sample does not contain TB infection. The detection chip will be loaded with T7 exonuclease, cas14 + guide RNA complex, FQ pairs. After a set amount of time, the laser will be switched on, and the beam will be directed to the chip. The detection of fluorescence will prove the presence of MDR-TB in the given sample.
The components in the chip, the pellet tube, and the sample collection tube are then discarded for the next detection cycle.

Test: The assembled automated hardware design will be made to go through the same preliminary analysis. If the hardware achieves a satisfactory result, it will be sent for clinical trials after proper approvals and conformations, including necessary bio-safety documentation.


Dealing with unexpected results:

  1. Transformation not working:
    1. Potential reasons:- mistakes in certain steps.
    2. Solution:- Maintaining a logbook is very important as it will help to troubleshoot the mistake we made while performing the experiment. After troubleshooting, if we find a mistake in any step we can redo the experiment by taking proper precautions.
  2. eLAMP not working for NEB primers:
    1. Potential reasons:- issues with designing primers.
    2. Solution:- This problem can be solved by designing primers on LAVA and Primer explorer as they are supported by eLAMP software. Further eLAMP software can also be modified so that it takes primers made by different methods. The electronically simulated lamp just like online PCR is a very useful tool for researchers and its importance is increasing due to the increased use of LAMP and other isothermal techniques in diagnostic kits.




References

[1] Kim, D.Y., Lee, J.M., Moon, S.B. et al. Efficient CRISPR editing with a hypercompact Cas12f1 and engineered guide RNAs delivered by adeno-associated virus. Nat Biotechnol (2021).https://doi.org/10.1038/s41587-021-01009-z

[2]Harrington, L. B., Burstein, D., Chen, J. S., Paez-Espino, D., Ma, E., Witte, I. P., Cofsky, J. C., Kyrpides, N. C., Banfield, J. F., & Doudna, J. A. (2018). Programmed DNA destruction by miniature CRISPR-Cas14 enzymes. Science (New York, N.Y.), 362(6416), 839–842.https://doi.org/10.1126/science.aav4294

[3]Yao C, Zhu T, Li Y, Zhang L, Zhang B, Huang J, Fu W. Detection of rpoB, katG and inhA gene mutations in Mycobacterium tuberculosis clinical isolates from Chongqing as determined by microarray. Clin Microbiol Infect. 2010 Nov;16(11):1639-43.https://doi.org/10.1111/j.1469-0691.2010.03267.x

[4]Prasad, P. G., Jasmine, M. S., kanta, K. N. M., Deepthi, K., & Allam, U. S. (2019). Analysis of drug resistance mutations in pulmonary Mycobacterium tuberculosis isolates in the Southern coastal region of Andhra Pradesh, India. The Brazilian Journal of Infectious Diseases. doi:10.1016/j.bjid.2019.07.002https://www.ingentaconnect.com/content/iuatld/ijtld/2015/00000019/00000004/art00013

[5]Singhal, R., Arora, J., Sah, G. C., Bhalla, M., Sarin, R., & Prasad Myneedu, V. (2017). Frequency of multi-drug resistance and mutations in Mycobacterium tuberculosis isolates from Punjab state of India. Journal of Epidemiology and Global Health, 7(3), 175–180. doi:10.1016/j.jegh.2017.05.002https://www.nature.com/articles/s41598-020-74432-y

[6]Jain, A., Singh, P. K., Chooramani, G., Dixit, P., & Malhotra, H. S. (2016). Drug resistance and associated genetic mutations among patients with suspected MDR-TB in Uttar Pradesh, India. The International Journal of Tuberculosis and Lung Disease, 20(7), 870–875. doi:10.5588/ijtld.15.0874

[7]Chatterjee, S., Jain, Y., & Poonawala, H. (2018). Drug-resistant tuberculosis: Is India ready for the challenge? In BMJ Global Health (Vol. 3, Issue 4).https://doi.org/10.1136/bmjgh-2018-000971

[8]Nguyen, T. N. A., Berre, V. A. le, Bañuls, A. L., & Nguyen, T. V. A. (2019). Molecular diagnosis of drug-resistant tuberculosis; A literature review. Frontiers in Microbiology, 10(MAR).https://doi.org/10.3389/fmicb.2019.00794

[9]Migliori, G. B., Matteelli, A., Cirillo, D., & Pai, M. (2008). Diagnosis of multidrug-resistant tuberculosis and extensively drug-resistant tuberculosis: Current standards and challenges. In Canadian Journal of Infectious Diseases and Medical Microbiology (Vol. 19, Issue 2).https://doi.org/10.1155/2008/857901

[10]Electronic LAMP:https://lamp.neb.com/#!/

[11]Electric LAMP: Virtual Loop-Mediated Isothermal AMPlification Nelson R. Salinas and Damon P. Little https://doi.org/10.5402/2012/696758

[12]Warmstart Colorimetric LAMP 2X Master Mix (DNA & RNA)https://international.neb.com/products/m1800-warmstart-colorimetric-lamp-2x-master-mix-dna-rna#Product%20Information

[13] Fozouni et al., 2021, Cell 184, 323–333 January 21, 2021, ª 2020 Elsevier Inc.https://doi.org/10.1016/j.cell.2020.12.001