Team:IISER Berhampur/Parts

Parts_2021

Since we did not have lab access for most of the iGEM 2021 period and our access to lab materials got delayed due to the lockdown restrictions, we planned to optimize our approach for cloning and transformation experiment protocols for these parts using in-silico RE digestion and gel electrophoresis. To know more about this, check the Results section.

What is a CRISPR/Cas system?

CRISPR (Clustered Regularly Interspaced Short Palindromic Repeats) are characteristic DNA sequences found in archaea and bacteria. They are the microbial defence systems to protect themselves against invading foreign DNA and RNA. The CRISPR sequences are derived from bacteriophages that have previously infected the bacteria, thus it works as an adaptive immune system for the prokaryote. They are associated with nucleases called Cas proteins¹ Based on the number and composition of proteins involved in nucleic acid interference, Cas proteins are categorized into classes 1- 2, further subdivided into types Ⅰ - Ⅵ.² The spCas9 from S. pyogenes is the wildtype Cas9 is the most widely used tool by scientists for genome editing.³

spCas9

In recent years, CRISPR/Cas technology has revolutionized genome editing. The Cas proteins such as Cas9 and Cas12 cleave dsDNA near a short sequence called as Protospacer Adjacent Motif (PAM). These are RNA guided mechanisms which use the CRISPR RNA (crRNA) and Trans-activating CRISPR RNA (tracrRNA) or a single guide RNA (sgRNA) containing both these sequences and a 20 nucleotide spacer sequence that is complementary to a target sequence. Although both the Cas proteins are widely used, scientists encountered problems such as constraints in cellular delivery due to its size and some off-target effects. Also, its PAM dependent mechanism puts a limit on its application in various experiments. So, instead of these, scientists needed some highly compact nucleases which can cleave DNA without PAM specificity and minimal off-target effects - and here comes the Cas14a1 protein in our project! This year, our team pioneered to introduce this exclusively new part in the Parts Registry.

Cas14a1 sgRNA complex

Basic Parts

The proposed parts that will be generated in project CODE M are as follows:

Serial No.	Description	Part No.	Type	Length(bp)
1	Cas14a1 expression gene	BBa_K3982001	Coding	1587
2	Tobacco Etch Virus (TEV) protease	BBa_K3982002	Coding	21
3	6x Histidine Tag	BBa_K3982003	Tag	18
4	CODE M sgRNA for targeting wildtype katG gene in Mycobacterium tuberculosis	BBa_K3982004	RNA	222
5	CODE M sgRNA for targeting mutant katG gene in Mycobacterium tuberculosis	BBa_K3982005	RNA	222
6	CODE M sgRNA for targeting wildtype rpoB gene in Mycobacterium tuberculosis	BBa_K3982007	RNA	222
7	CODE M sgRNA for targeting mutant rpoB gene in Mycobacterium tuberculosis	BBa_K3982008	RNA	222
8	Lac Operator	BBa_K3982009	Regulatory	17
9	Lac Promoter	BBa_K3982010	Regulatory	31
10	CAP Binding Site	BBa_K3982011	Regulatory	22
11	Xenopus Beta-Globin 3’ UTR	BBa_K3982012	Regulatory	126
12	Xenopus Beta-Globin 5’ UTR	BBa_K3982013	Regulatory	43
13	tetR/tetA bidirectional promoter	BBa_K3982014	Regulatory	56
14	tetR - Tetracycline repressor gene	BBa_K3982015	Coding	624
15	Cat Promoter	BBa_K3982016	Regulatory	103
16	Chloramphenicol Resistance (CmR)	BBa_K3982017	Coding	660
17	Lambda t0 terminator	BBa_K3982018	Regulatory	95
18	T7Te terminator	BBa_K3982019	Regulatory	28
19	p15A ori	BBa_K3982024	Coding	546
20	Ampicillin Resistance (AmpR) promoter	BBa_K3982027	Regulatory	105
21	Ampicillin Resistance (AmpR) gene	BBa_K3982028	Coding	861
22	Ori	BBa_K3982029	Ori	589
23	Tet operator (tetO)	BBa_K3982034	Regulatory	19

Composite Parts

The proposed parts that will be generated in project CODE M are as follows:

Serial No.	Description	Part No.	Components	Strategy	Type	Length
1	6xHis - Tagged Cas14a1 with TEV site	BBa_K3982006	BBa_K3982001, BBa_K3982002, BBa_K3982003	Remove the 6x His Tag, TEV protease and Cas14a1 gene by inserting RE sites Xba1 and Spe1 in Addgene #112502 using SDM. Avoid using EcoR1 and Pst1	Composite	1641
2	CODE M Construct C1	BBa_K3982025	BBBa_K3982015, BBa_K3982014, BBa_B0034, BBa_K3982006, BBa_B0013	Parts from Addgene #112502 are PCR amplified and cloned in pSB1C3. Consists of BBa_K3982006	Project	2962
3	CODE M (Standard) Construct S1	BBa_K3982026	Bba_K1614000, BBa_B0034, BBa_K3982006, BBa_B0013	Parts from construct C1 assembled with T7 promoter, RBS and T7Te terminator and cloned in pSB1C3.	Project	677
4	CODE M Construct C2	BBa_K3982030	BBa_K3982011, BBa_K3982010, BBa_K3982009, BBa_K3982012, BBa_K3982004, BBa_K3982013, BBa_J64998	sgRNA sequence (BBa_K3982004) inserted using SDM in Addgene # 15030	Project	677
5	CODE M Construct C3	BBa_K3982031	BBa_K3982011, BBa_K3982010, BBa_K3982009, BBa_K3982012, BBa_K3982005, BBa_K3982013, BBa_J64998	sgRNA sequence (BBa_K3982005) inserted using SDM in Addgene # 15030	Project	677
6	CODE M Construct C4	BBa_K3982032	BBa_K3982011, BBa_K3982010, BBa_K3982009, BBa_K3982012, BBa_K3982007, BBa_K3982013, BBa_J64998	sgRNA sequence (BBa_K3982007) inserted using SDM in Addgene # 15030	Project	677
7	CODE M Construct C5	BBa_K3982033	BBa_K3982011, BBa_K3982010, BBa_K3982009, BBa_K3982012, BBa_K3982008, BBa_K3982013, BBa_J64998	sgRNA sequence (BBa_K3982008) inserted using SDM in Addgene # 15030	Project	677
8	CODE M Construct S2	BBa_K3982038	BBa_K1614000, BBa_B0034, BBa_K3982012, BBa_K3982004, BBa_K3982013, BBa_B0013	Parts from Construct C2 assembled with T7 promoter, RBS and T7Te terminator.	Project	510
9	CODE M Construct S3	BBa_K3982039	BBa_K1614000, BBa_B0034, BBa_K3982012, BBa_K3982005, BBa_K3982013, BBa_B0013	Parts from Construct C3 assembled with T7 promoter, RBS and T7Te terminator.	Project	510
10	CODE M Construct S4	BBa_K3982040	BBa_K1614000, BBa_B0034, BBa_K3982012, BBa_K3982007, BBa_K3982013, BBa_B0013	Parts from Construct C4 assembled with T7 promoter, RBS and T7Te terminator.	Project	510
11	CODE M Construct S5	BBa_K3982041	BBa_K1614000, BBa_B0034, BBa_K3982012, BBa_K3982008, BBa_K3982013, BBa_B0013	Parts from Construct C5 assembled with T7 promoter, RBS and T7Te terminator.	Project	510

6xHis - Tagged Cas14a1 gene with TEV site (i.e. Part BBa_K3982006) It is a composite part that has been assembled using basic parts BBa_K3982001, BBa_K3982002 and BBa_K3982003. The 6x Histidine tag will be used for purification of the recombinant Cas14a1 protein by using immobilized metal affinity chromatography (IMAC). TEV protease will be used for removal of the 6x His tag after purification of Cas14a1 by cleaving between Glutamine and Serine residues in its sequence.

CODE M Construct C1(i.e. Part BBa_K3982025) It is a composite project part that has been assembled using Tet repressor (TetR), Tet operator (TetO), overlapping tetR/tetA promoters, RBS, coding sequences for 6x His tag, TEV protease and Cas14a1 (i.e. Part BBa_K3982006) and T7Te terminator. This construct is to be used for tetracycline induced expression of the recombinant Cas14a1 protein.⁵

Plasmid map of C1 showing the design of the construct. Created using SnapGene

CODE M Constructs C2, C3, C4 and C5 (Part Numbers: BBa_K3982030, BBa_K3982031, BBa_K3982032, BBa_K3982030) are the composite project parts used for the in-vitro synthesis of our customized CODE M sgRNAs (see the table for basic parts). sgRNAs are inserted using site-directed mutagenesis in Addgene Plasmid # 15030, which is a vector having Xenopus 5’ and 3’ untranslated β-globin sequences to enhance the transcription of our synthetic CODE M sgRNAs using SP6 promoter. The expression is controlled by using lactose inducible promoter (lac promoter), lac operator along with a CAP (Catabolite activator protein) binding site.⁶

Plasmid maps of CODE M Constructs with customized sgRNA. C2 and C4 have spacer sequences (also called as guiding region) complementary to the regions of wild type katG and rpoB genes respectively. C3 and C5 have spacer sequences complementary to the mutated regions of katG and rpoB genes respectively. The scaffold sequences are in blue in all maps. Created using SnapGene

To test efficiency of gene expression in our Constructs C1, C2, C3, C4 and C5, we propose to build standard constructs S1, S2, S3, S4 and S5 respectively (see the table for composite parts). These have some well characterized and commonly used T7 promoters, RBS and T7Te terminators assembled with CODE M sgRNAs.

CODE M sgRNAs

The following table shows the spacer sequences proposed to be used in project CODE M for constructs C2, C3, C4 and C5 as well as the respective standard constructs S2, S3, S4, and S5. All spacer sequences have been referred from NCBI Database ⁷

Gene	Spacer Sequence	Mutation	Spacer Sequence	Phenotypic expression in mutant Mtb
katG - (encodes for catalase- peroxidase enzyme)	5’ gcgatcaccagcggcatcga 3’	agc→acc	5’ gcgatcaccaccggcatcga 3’	Drug resistance to Isoniazid
rpoB - (encodes for β subunit of bacterial RNA polymerase)	5’ cgccgactgtcggcgctggg 3’	tcg→ttg	5’ cgccgactgttggcgctggg 3’	Drug resistance to Rifampicin

Scaffold region sequence: (References - [4], [5])
5’CTTCACTGATAAAGTGGAGAACCGCTTCACCAAAAGCTGTCCCTTAGGGGATTAGA
ACTTGAGTGAAGGTGGGCTGCTTGCATCAGCCTAATGTCGAGAAGTGCTTTC
TTCGGAAAGTAACCCTCGAAACAAATTCATTTgaaaGAATGAAGGAATGCAAC 3’

Existing Parts

Along with our CODE M Parts, we propose to use the following existing BioBricks in the constructs.

Bio Brick	Part No.
T7 Promoter	BBa_K1614000
SP6 Promoter	BBa_J64998
RBS	BBa_B0034
T7TE Terminator	BBa_B0013

Using our CODE M sgRNA constructs will enable any experimenter to synthesize their own sgRNA by just replacing the spacer sequences with the sequences of their choice. Thus, our CODE M parts provide the design information and will contribute to revolutionizing the use of CRISPR/Cas tools for synthetic biology.

References

Koonin, E. V., Makarova, K. S., & Zhang, F. (2017). Diversity, classification and evolution of CRISPR-Cas Systems. Current Opinion in Microbiology, 37, 67–78. https://doi.org/10.1016/j.mib.2017.05.008.
Jiang, F., & Doudna, J. A. (2017). CRISPR–cas9 structures and mechanisms. Annual Review of Biophysics, 46(1), 505–529.https://doi.org/10.1146/annurev-biophys-062215-010822.
Makarova, K. S., Wolf, Y. I., Iranzo, J., Shmakov, S. A., Alkhnbashi, O. S., Brouns, S. J., Charpentier, E., Cheng, D., Haft, D. H., Horvath, P., Moineau, S., Mojica, F. J., Scott, D., Shah, S. A., Siksnys, V., Terns, M. P., Venclovas, Č., White, M. F., Yakunin, A. F., … Koonin, E. V. (2019). Evolutionary classification of CRISPR–Cas Systems: A burst of class 2 and derived variants. Nature Reviews Microbiology, 18(2), 67–83.https://doi.org/10.1038/s41579-019-0299-x
Kim, D.Y., Lee, J.M., Moon, S.B. et al. Efficient CRISPR editing with a hypercompact Cas12f1 and engineered guide RNAs delivered by adeno-associated virus. Nat Biotechnol (2021).https://doi.org/10.1038/s41587-021-01009-z
Harrington, L. B., Burstein, D., Chen, J. S., Paez-Espino, D., Ma, E., Witte, I. P., Cofsky, J. C., Kyrpides, N. C., Banfield, J. F., & Doudna, J. A. (2018). Programmed DNA destruction by miniature CRISPR-Cas14 enzymes. Science (New York, N.Y.), 362(6416), 839–842.https://doi.org/10.1126/science.aav4294
Krieg, P. A., & Melton, D. A. (1984). Functional messenger RNAS are produced by sp6in vitro transcription of cloned cdnas. Nucleic Acids Research, 12(18), 7057–7070.https://doi.org/10.1093/nar/12.18.7057.
Mycobacterium tuberculosis H37Rv, complete genome. NCBI Reference Sequence: NC_000962.3.https://www.ncbi.nlm.nih.gov/nuccore/NC_000962.3(2010).

[1] Koonin, E. V., Makarova, K. S., & Zhang, F. (2017). Diversity, classification and evolution of CRISPR-Cas Systems. Current Opinion in Microbiology, 37, 67–78. https://doi.org/10.1016/j.mib.2017.05.008.

[2] Jiang, F., & Doudna, J. A. (2017). CRISPR–cas9 structures and mechanisms. Annual Review of Biophysics, 46(1), 505–529.https://doi.org/10.1146/annurev-biophys-062215-010822.

[3] Makarova, K. S., Wolf, Y. I., Iranzo, J., Shmakov, S. A., Alkhnbashi, O. S., Brouns, S. J., Charpentier, E., Cheng, D., Haft, D. H., Horvath, P., Moineau, S., Mojica, F. J., Scott, D., Shah, S. A., Siksnys, V., Terns, M. P., Venclovas, Č., White, M. F., Yakunin, A. F., … Koonin, E. V. (2019). Evolutionary classification of CRISPR–Cas Systems: A burst of class 2 and derived variants. Nature Reviews Microbiology, 18(2), 67–83.https://doi.org/10.1038/s41579-019-0299-x

[4] Kim, D.Y., Lee, J.M., Moon, S.B. et al. Efficient CRISPR editing with a hypercompact Cas12f1 and engineered guide RNAs delivered by adeno-associated virus. Nat Biotechnol (2021).https://doi.org/10.1038/s41587-021-01009-z

[5] Harrington, L. B., Burstein, D., Chen, J. S., Paez-Espino, D., Ma, E., Witte, I. P., Cofsky, J. C., Kyrpides, N. C., Banfield, J. F., & Doudna, J. A. (2018). Programmed DNA destruction by miniature CRISPR-Cas14 enzymes. Science (New York, N.Y.), 362(6416), 839–842.https://doi.org/10.1126/science.aav4294

[6] Krieg, P. A., & Melton, D. A. (1984). Functional messenger RNAS are produced by sp6in vitro transcription of cloned cdnas. Nucleic Acids Research, 12(18), 7057–7070.https://doi.org/10.1093/nar/12.18.7057.

[7] Mycobacterium tuberculosis H37Rv, complete genome. NCBI Reference Sequence: NC_000962.3.https://www.ncbi.nlm.nih.gov/nuccore/NC_000962.3(2010).