Team:YiYe-China/Engineering
Result
CRC is one of the most common cancers; worse than that, it is also one of the leading causes of cancer-related death globally. Therefore, effectively detecting colorectal cancer is the key to control the spreading and the deterioration of this cancer. Though we have many current colorectal cancer detection methods like CT scan, colonoscopy, biopsy, etc., they all have limitations and side effects. Due to such issues, people with colorectal symptoms are unwilling to get tested, resulting in cancer spread and cancer worsening, eventually resulting in a high death rate. Therefore, we are interested in developing a new non-invasive method to help diagnosis colorectal cancer in the future.
According to the literature，We found that Aberrant methylation of TFPI2 was detected in almost all CRC adenomas and stage I to IV CRCs. So, detection of TFPI2 methylation in stool DNA may act as a useful adjunct to the noninvasive strategies for screening of CRCs. We plan to construct a toehold switch biosensor, which is connected with a Fluorescent protein as a reporter, to detect TFPI2 methylation for early diagnosis of colorectal cancer. We will synthesis and clone trigger sequence and toehold sequence to the plasmids. Then we will test the potential role of our designed parts to detect Hypemethylated gene TPFI2 in cell free system.
According to our design, we plan to verify our idea by Co-transformation in E.coli and PCR. The co-transformation experiment can prove that the toehold system inserted with the target gene sequence can work normally; PCR experiments show that our TFPI2 part can be used as a biomarker for colorectal cancer detection.
1. Co-transformation verification
1.1 plasmid construction
In order to realize the co-transformation of two different plasmids to E. coli to run the functions, two plasmids need to have different origin of replication(ori). Therefore, we constructed the Toehold sequence and mcherry sequence onto PSB1C3 and constructed the trigger sequence containing the target gene onto pCOLADuet. We used SpeI / XbaI enzyme digestion PSB1C3 vector, ECOR I / Sal I enzyme digestion pCOLADuet vector, the synthesis of Toehold sequence and TFPI2-trigger sequence were linked to the enzyme digestion of PSB1C3 vector and pCOLADuet vector. Then the ligation products were transformed into DH5alpha bacteria, positive clones were selected on LB plate containing chloramphenicol and kana antibiotics respectively. After overnight incubator at 37 ℃ , the positive clones were picked out and amplified in LB tube for 6 hours, and then 100ul bacteria solution was extracted and sent to Tsingke biology company for sequencing of bacteria solution.
Figure1: Construction of Toehold switch-related plasmids. A: PSB1C3 plasmid vector map and pCOLADuet™-1 plasmid vector map ; B: PSB1C3 restriction enzyme digest with SpeI/XbaI (left) and pCOLADuet™-1 restriction enzyme digest with EcoR I/Sal I（right); C: Positive clone of PS1C3-Toehold recombinant (left) and positive clone of pCOLAduet-TFPI2-trigger recombinant (right); D：Sequencing results of PS1C3-Toehold recombiner and pCOLAduet-TFPI2-trigger recombiner.
1.2 pCOLAD-TFPI2-trigger and PB1C3-Toehold-mcherry were co-transferred into E.coli
Figure2: Toehold switch function verification. A: PSB1C3-Toehold and pCOLADuet-TFPI2-trigger were co-transferred into DH5α; B: Expression of red Fluorescent induced by IPTG in different bacterias. C: Observation of bacterias under fluorescence microscope; D: Statistics of detection data and results of fluorescent bacteria on Microplate Reader.
The constructed plasimds PSB1C3-Toehold and pCOLADuet-TFPI2-trigger were cotransforred into DH5alpha. the constructed stain was then cultured overnight in 37 ℃ incubator in a double resistance LB plate containing chloramphenicol and kanamycin. Positive cloney was selected into 6ml LB. The bacteria was shaked at 160rpm in a 37-degree shaker until the OD600 reaches 0.4-0.6, add IPTG, a protein inducer with a final concentration of 1mM, and induce overnight at 160rpm in a 26-degree shaker. After induction, We can observe that there is no fluorescence in the toehold alone group and there is bovious red light in the Toehold with TFPI2-trigger group and the positive control group (Part K3577001), which is in consistent with the fluorescence results observed under fluorescence microscope. 100ul bacteria solution was taken from each group and was used to detect the red fluorescence intensity on Microplate Reader at 587 nm excitation light 610nm receiving light. The results showed that TFPI2-trigger group had obvious red fluorescence intensity compared with thecontrol group. In general, the toehold system inserted with the target gene TFPI2 sequence can work normally.
1.3 summary
By the co-transformation experiment, we can obviously see red light from the phenotype. At the same time through fluorescence detection, we can also see that the fluorescence signal is significantly different form that of the control group. In general, the Toehold switch system we designed works normally.
2. PCR verification
2.1 primer design
We plan to use the In Vitro protein expression system to detect the methylation degree of the TFPI2 gene in colorectal cancer patients. According to the literature, we designed methylation-specific primers forTFPI2. In order to express in vitro, T7 promoter and trigger sequence were added to the 5 'end of TFPI methylation forward and reverse primers, respectively. For normalization，we also designed unmethylated primers for the internal reference gene ACTB. Same as TFPI2, T7 promoter sequence was added to its forward primer, trigger primer sequence was added to its reverse primer, and a new primer was synthesized respectively. TFPI2-M: methylation specific primer T7-TFPI2-F：TAATACGACTCACTATAGGGCGCGGAGATTTTTTGT Trigger-TFPI2-R：TATGTAATTGATTTGGCTTCTGTTAGTTTCATATTTAACAAACATCGTCGCAAACCTC PCR product: 164bp ACTB-NM: unmethylated primer T7-ACTB-F：TAATACGACTCACTATAGGGGGCACCCAGCACAATGAAG Trigger-ACTB-R：TATGTAATTGATTTGGCTTCTGTTAGTTTCATATTTCATACTCGTCATACTCCTGCTTGCTG PCR product: 133bp (The red is T7 and the blue is Trigger)
2.2 PCR verification
Using human species genome DNA and simulated colorectal cancer genome DNA as templates, PCR amplification were carried out on PCR instrument with the same number of gene amplification cycles, and then verified by agarose gel electrophoresis. From the figure below, we can see that ACTB as an internal control has the same expression in both negative and positive samples, while TFPI2, as a biomarker of colorectal cancer, has a weak band (almost invisible) in negative sample and a significant band in positive sample. Which means that the TFPI2 methylation degree has a significant differences between negative and positive samples. This confirms our conjecture that TFPI2 can be used as a biomarker for colorectal cancer detection, and there are significant differences in negative and positive samples.
Figure3: TFPI2 colorectal cancer detection (PCR verification). A: PCR products were detected by agarose gel electrophoresis; Marker：50bp DNA Ladder，Line 1: negative colorectal cancer specimen with ACTB non-methylation specific primers，Line 2: negative colorectal cancer samples with TFPI2 methylation specific primers，Line 3: positive colorectal cancer samples with ACTB non-methylation specific primers，Line 4: positive colorectal cancer samples with TFPI2 methylation specific primers B: qPCR experimental results analysis..
2.3 Summary:
The results were as anticipated: for methylation detection of TFPI2, band was almost invisible in negative colorectal cancer samples, and obvious bands were found in positive samples. The result shows that our parts can work as expected.
3. Add the methylation degree detection of SDC2 to improve product accuracy
According to the advice given by Dr. Xiaoqing, "Multiple genetic testing can improve the accuracy and sensitivity of the product, but too many genes will bring about cost increase, complexity, and other negative effects". We decided to add another gene SDC2，together with TFPI2， as a detector to determine whether it is colorectal cancer.
Same to TFPI2, we conducted a lot of literature research, selected a methylation-enriched region of SDC2 and designed methylation-specific primers. T7 promoter was added to its forward primer and trigger primer was added to its reverse primer. The primer we designed are below: SDC2-M: methylation specific primer F: 5′- TAATACGACTCACTATAGGGGTGTAGAAATTAATAAGTGAGAGGG-3′ R: 5′- TATGTAATTGATTTGGCTTCTGTTAGTTTCATATTTCTACTTACAACCAAAACAAAAC-3′ PCR product：264bp (The red is T7 and the blue is Trigger)
Due to time reasons, we did not conduct experimental verification, but the exact same experiment as TFPI2 determines the success of the experiment.
Reference：
[1] Green A , Silver P , Collins J , et al. Toehold switches: de-novo-designed regulators of gene expression.[J]. Cell, 2014, 159(4):925-939. [2] Zhang, Weisong, et al. “SDC2 And TFPI2 Methylation in Stool Samples as an Integrated Biomarker for Early Detection of Colorectal Cancer.” Cancer Management and Research, Dove, 30 Apr. 2021, www.ncbi.nlm.nih.gov/pmc/articles/PMC8096344/.
Result
The result of our project
-
1. Co-transformation verification
1.1 plasmid construction
1.2 Co-transformation into E.coli
1.3 Summary
-
PCR verification
1.1 primer design
1.2 qPCR verification
1.3 Summary
- Reference