Team:TUDelft/Parts

Team

Team Members Collaborations Attributions Sponsors

Project

Project Description Design Engineering Success Results Hardware Contribution Sequencing analysis Partnership Sustainable Development

Lab

Protocols Notebook Parts

Model

Model

Human Practices

Human Practices Integrated Human Practices Education & Public Engagement Proposed Implementation Safety Entrepreneurship

Achievements

Judging Form Medal Criteria Awards and Nominations

Parts

On this page, we show an overview of all our basic and composite genetic parts we have added to the parts registry. Additionally, we show the parts that form our part collection.

Basic parts

Favorite part	Name	Type	Description
	BBa_K3806008	RNA	Theophylline-binding aptazyme
	BBa_K3806010	RNA	Theophylline-binding aptazyme enclosed by RBS and anti-RBS (cRBS)
	BBa_K3806012	Coding	lacZ reporter gene codon optimized for expression in E. coli
	BBa_K3806015	RNA	Theophylline-binding aptazyme enclosed by RBS and anti-RBS (semi-cRBS)
	BBa_K3806017	Primer	RT primer for uncleaved selection + PCR reverse primer
	BBa_K3806018	Primer	RT primer/splint for W prefix addition
	BBa_K3806019	Primer	RT primer/splint for Z prefix addition
	BBa_K3806020	Primer	PCR forward primer for W prefix
	BBa_K3806021	Primer	PCR forward primer for Z prefix

Favorite basic part

Our favorite basic part is BBa_K3806008, which contains a theophylline-binding aptazyme engineered through a novel in vitro evolutionary experiment, DRIVER, in the study of Townshend et al. [1]. This aptazyme is evolved to undergo self-cleavage in the presence of theophylline and to remain uncleaved when the ligand is bound. We verified the cleavage activity of this theophylline-binding aptazyme, and demonstrated the value of this part when used as a positive control in the setup and course of DRIVER experiments. Moreover, we showed the potential of this aptazyme to regulate gene expression in vitro.

Composite parts

Favorite part	Name	Type	Description
	BBa_K3806011	Composite	Theophylline-binding aptazyme with T7 promoter
	BBa_K3806014	Composite	Theophylline-binding aptazyme regulating lacZ expression (cRBS) with T7 promoter
	BBa_K3806016	Composite	Theophylline-binding aptazyme regulating lacZ expression (semi-cRBS) with T7 promoter

Favorite composite part

Our favorite composite part is BBa_K3806016, a novel genetic switch construct in which an aptazyme sequence is fused to the lacZ reporter gene to convert ligand concentration to a colorimetric read-out. This part contains a theophylline-binding aptazyme sequence [1], although it should be noted that this part is designed to be modular and serve as a template to engineer other ligand-specific genetic circuits by swapping the aptazyme domain. This part was successfully expressed in a cell-free system, and its biosensing performance was compared to BBa_K3806014, showing an improvement in the dynamic range and time-response capabilities.

Part collection

Our part collection provides the iGEM community with an ‘Aptazyme Toolbox’ to accelerate the in vitro engineering of biosensors for (virtually any) small molecules of interest of the user. This is relevant since sensing small molecules is the foundation of many applications, ranging from disease diagnosis, prognosis, or treatment to detecting small pollutants in the environment.

Our toolbox consists of (i) a set of primers required for in vitro evolution of novel biosensors using DRIVER [1], a newly developed method for aptazyme engineering, (ii) a characterized aptazyme that can be used as a positive control in this process, (iii) potential vitamin-specific aptazymes generated during our laboratory evolution stage, and (iv) an aptazyme fused to a lacZ reporter gene for converting ligand concentration into a colorimetric output. The latter construct is designed to be modular, and can be used by other iGEM teams as a template to engineer other ligand-specific genetic circuits by swapping the aptazyme domain (Fig. 1).

Fig. 1. Aptazyme toolbox. Animation of the modularity of the biosensor. Engineered aptazyme sequences are introduced into the genetic circuit without any change in the read-out system.

Favorite part	Name	Type	Description
	BBa_K3806008	RNA	Theophylline-binding aptazyme
	BBa_K3806011	Composite	Theophylline-binding aptazyme. Transcription controlled under T7 promoter
	BBa_K3806012	Coding	lacZ reporter gene codon optimized for expression in E. coli
	BBa_K3806015	RNA	Theophylline-binding aptazyme enclosed by RBS and anti-RBS (semi-cRBS)
	BBa_K3806016	Composite	Theophylline-binding aptazyme regulating lacZ expression (semi-cRBS) with T7 promoter
	BBa_K3806017	Primer	RT primer for uncleaved selection + PCR reverse primer
	BBa_K3806018	Primer	RT primer/splint for W prefix addition
	BBa_K3806019	Primer	RT primer/splint for Z prefix addition
	BBa_K3806020	Primer	PCR forward primer for W prefix
	BBa_K3806021	Primer	PCR forward primer for Z prefix

Potential vitamin-specific aptazyme sequences	Library
GCTGTCACAGGTCTTCTGTCTGACGAGTCCTTGGCCGGACGAAACAGC	Vitamin B9
GCTGTCACCGGAAATCTTTTTGTACGCTACGAGTCACCGTTATCCGGTCTGAAGAGTCCATCGGTGGGACGAAACAGC	Vitamin B9
GCCTGTCATCGGATTCCATCCGGTCTGACGAGTCCTTGGCGGGACGAAACAGC	Vitamins B1, B2, B6, B12
GCTGTCACCGGAAGTCTTTTTGTACGCTACGAGTCACCGTTATCCGGTCTGAAGAGTCCATCGGTGGGACGAAACAGC	Vitamins B1, B2, B6, B12
GCTGTCACCGGAGTATTCTTGTTTGCTAATTGCGTCATCCGTTCCGGTCTGATGAGTCCAGTGGGGGACGAAACAGC	Vitamins B1, B2, B6, B12

References

1. Townshend, B., Xiang, J. S., Manzanarez, G., Hayden, E. J. and Smolke, C. (2021). A multiplexed, automated evolution pipeline enables scalable discovery and characterization of biosensors. Nat Commun, 12, 1437.

A big thank you to our sponsors!