Team:TUDelft/Experiments

Team

Team Members Collaborations Attributions Sponsors

Project

Project Description Design Engineering Success Results Hardware Contribution Sequencing analysis Partnership Sustainable Development

Lab

Protocols Notebook Parts

Model

Model

Human Practices

Human Practices Integrated Human Practices Education & Public Engagement Proposed Implementation Safety Entrepreneurship

Achievements

Judging Form Medal Criteria Awards and Nominations

Protocols

This section provides a step by step description of the protocols that we used for our experiments. The protocols are categorized per wetlab module.

General protocols

Agar plates

1. Dissolve 14.24 g of Lysogeny Broth (LB) agar in 400 ml distilled water.
2. Autoclave the LB agar solution.
3. Cool down the solution before adding antibiotics. To speed up the process, you can hold the bottle under cold tap water while stirring.
4. Supply with the appropriate antibiotics. When using 1000X antibiotic stock solutions, add 1 µl of the antibiotic stock solution per ml of LB agar.
5. Under sterile conditions, pour the LB agar in sterile Petri dishes.
6. Leave the Petri dishes near the flame with the lid partially off for approximately 5 minutes so the agar can solidify.
7. Store at 4 °C until use.

Antibiotic stock solution

For 1000X antibiotic stock solutions:

1. Weight X grams of the antibiotic of interest.
2. Dissolve in 95% ethanol (Chloramphenicol) or Milli-Q water (other antibiotics).
3. Filter the solution using a 45 µm filter.

DNA concentration determination

Using NanoDrop UV-Vis Spectophotometer

1. Press the button dsDNA to measure the concentration of double stranded DNA in your samples.
2. Clean the measurement surface with kimwipes and Milli-Q water.
3. Use 1 µl of the same buffer the sample is dissolved in to set the blank.
4. Use 1 µl of sample to measure its concentration. If you have multiple samples, clean the measurement surface in between measurements with kimwipes.

Using Qubit® dsDNA HS Assay Kits

1. Set up the required number of 0.5 ml tubes for standards and samples. The Qubit® dsDNA HS Assay requires 2 standards. Use only thin-wall, clear, 0.5 ml PCR tubes.
2. Label the tube lids. Note: Do not label the side of the tube as this could interfere with the sample read.
3. Prepare the Qubit® working solution by diluting the Qubit® dsDNA HS Reagent 1:200 in Qubit® dsDNA HS Buffer. Use a clean plastic tube each time you prepare a Qubit® working solution. Do not mix the working solution in a glass container. Note: The final volume in each tube must be 200 µl. Each standard tube requires 190 µl of Qubit® working solution, and each sample tube requires anywhere from 180-199 µl. Prepare sufficient Qubit® working solution to accommodate all standards and samples. For example, for 8 samples, prepare enough working solution for the samples and 2 standards: ~ 200 µl per tube in 10 tubes yields 2 ml of working solution (10 µl of Qubit® reagent plus 1990 µl of Qubit® buffer).
4. Add 190 µl of Qubit® working solution to each of the tubes used for standards.
5. Add 10 µl of each Qubit® standard to the appropriate tube, then mix by vortexing 2–3 seconds. Be careful not to create bubbles. Note: Careful pipetting is critical to ensure that exactly 10 µl of each Qubit® standard is added to 190 µl of Qubit® working solution.
6. Add Qubit® working solution to individual assay tubes so that the final volume in each tube after adding sample is 200 µl. Note: Your sample can be anywhere from 1-20 µl. Add a corresponding volume of Qubit® working solution to each assay tube: anywhere from 180-199 µl.
7. Add each sample to the assay tubes containing the correct volume of Qubit® working solution, then mix by vortexing 2-3 seconds. The final volume in each tube should be 200 µl.
8. Allow all tubes to incubate at room temperature for 2 minutes.
9. Read standards and samples following the procedure appropriate for your instrument.

Protocol adapted from Molecular probes Life Technologies (Qubit® dsDNA HS Assay Kits).

DNA and RNA electrophoresis

1. Prepare TBE 1X buffer. Take the 10X concentrated TBE and dilute it 10 times with Milli-Q water. For 500 ml, add 50 ml TBE 10X to 450 ml distilled water.
2. Weigh agarose for a 1% gel. For 50 ml, 0.5 g of agarose are necessary.
3. Mix 50 ml TBE 1X buffer with the 0.5 g agarose and heat the solution in a microwave at medium-low power until it is completely dissolved.
4. Wait for the mixture to cool down until it reaches a handable temperature and then add SYBR Safe stain. For a 50 ml gel, add 2 µl of SYBR Safe.
5. Pour the solution into the casting mold with the comb already mounted. Make sure there are no bubbles. Let it solidify (~ 20 minutes).
6. Transfer the gel to the electrophoresis cell, minding the arrow that indicates the direction of DNA migration. Remove the combs and cover it with TBE buffer.
7. Prepare the samples. For DNA samples, add the required volume of 6X DNA loading buffer to the sample (1 µl of Loading Buffer per 5 µl of sample). For RNA samples, add the required volume of 2X RNA loading buffer to the sample (1 µl of Loading Buffer per 1 µl of sample), and incubate the samples at 70 °C for 10 minutes.
8. Load the molecular ladder in the first well (verify the appropriate volume for each marker). Then, load the samples in the remaining wells.
9. Connect the cables following the color code and run at 90 V for 45 minutes or as required.

Gel & PCR Cleanup (Promega Wizard kit)

Gel Slice and PCR product preparation

A. Dissolving the Gel Slice

1. Following electrophoresis, excise the DNA band from the gel and place the gel slice in a 1.5 ml microcentrifuge tube.
2. Add 10 μl Membrane Binding Solution per 10 mg of gel slice. Vortex and incubate at 50–65 °C until the gel slice is completely dissolved.

B. Processing PCR products

1. Add equal volume of Membrane Binding Solution to the PCR product.

Binding, Washing, and Elution

1. Insert SV Minicolumn into Collection Tube.
2. Transfer dissolved gel mixture or prepared PCR product to the Minicolumn assembly. Incubate at room temperature for 1 minute.
3. Centrifuge at 16,000 x g for 1 minute. Discard flow-through and reinsert Minicolumn into Collection Tube.
4. Add 700 μl Membrane Wash Solution (ethanol added). Centrifuge at 16,000 x g for 1 minute. Discard flow-through and reinsert Minicolumn into Collection Tube.
5. Repeat Step 4 with 500 μl Membrane Wash Solution. Centrifuge at 16,000 x g for 5 minutes.
6. Empty the Collection Tube and centrifuge the column assembly for 1 minute with the microcentrifuge lid open (or off) to allow evaporation of any residual ethanol.
7. Carefully transfer Minicolumn to a clean 1.5 ml microcentrifuge tube.
8. Add 30 μl Milli-Q water to the Minicolumn. Incubate at room temperature for 1 minute. Centrifuge at 16,000 x g for 1 minute.
9. Discard Minicolumn. Measure DNA concentration and store at -20 °C.

Protocol adapted from Promega (Wizard® SV Gel and PCR Clean-Up System).

Glycerol stocks

1. Prepare a 80% (v/v) glycerol solution and sterilize by autoclaving.
2. Inoculate 10 ml LB liquid bacterial culture containing the appropriate antibiotic. Incubate at 37 °C overnight, shaking at 250 rpm.
3. Add 250 µl of the 80% glycerol solution to a sterile cryotube.
4. Add 750 µl of the liquid bacterial culture to the tube and mix well.
5. Store at -80 °C.

Lysogeny Broth liquid medium

1. Dissolve Lysogeny Broth (LB) powder in distilled water according to manufacturer instructions.
2. Autoclave the LB solution.
3. Store at room temperature until use.

Liquid bacterial culture inoculation

1. Prepare as many 50 ml falcon tubes as needed. Do not forget to prepare a negative control.
2. In sterile conditions, add 10 ml of LB liquid medium to each falcon tube.
3. Supply with the appropriate antibiotics. When using 1000X antibiotic stock solutions, add 10 µl of the antibiotic stock.
4. Pick a colony with the inoculation needle and transfer it to the liquid medium.
5. Incubate at 37 °C overnight, shaking at 250 rpm.

NEBuilder HiFi DNA assembly

1. Set up assembly reactions on ice according to the table below:

   Recommended amounts
   	Assembly of 2-3 fragments	Assembly of 4-6 fragments
   Vector:insert ratio	1:2	1:1
   Fragments	0.03-0.2 pmol	0.2-0.5 pmol
   NEBuildier HiFi DNA assembly Master mix	10 µl	10 µl
   Milli-Q water	X µl	X µl
   Final volume	20 µl	20 µl

2. Incubate at 50 °C for 15 minutes for 2-3 fragments; one hour for 4-6 fragment.
3. Store at -20 °C until use.

Protocol adapted from New England Biolabs (NEBuilder HiFi DNA assembly).

PCR (Q5 HF)

1. Add the following components in a PCR tube:

Component	Volume (µl)
Milli-Q water	X
Q5 High-Fidelity 2x Master Mix	10
10 µM FW Primer	2.5
10 µM RV Primer	2.5
10 mM dNTPs	1
DNA Template (< 1,000 ng)	Y
Q5 High-Fidelity DNA Polymerase	0.5
Final volume	50



2. Introduce the PCR tubes in the thermocycle and use the following PCR protocol:

Step	Temperature (°C)	Time	#cycles
Initial denaturation	98	30 seconds	1
Denaturation	98	5-10 seconds	25-35
Annealing	50-72 (based on Tm)	10-30 seconds	25-35
Extension	72	20-30 seconds/kb	25-35
Final Extension	72	2 minutes	1
Hold	12	∞

Protocol adapted from New England Biolabs (PCR Using Q5® High-Fidelity DNA Polymerase).

PCR (Phusion HF)

1. Add the following components in a PCR tube:

Component	Volume (µl)
Milli-Q water	X
5X Phusion HF or GC Buffer	10
10 µM FW Primer	2.5
10 µM RV Primer	2.5
10 mM dNTPs	1
DNA Template (< 250 ng)	Y
Phusion DNA Polymerase	0.5
Final volume	50



2. Introduce the PCR tubes in the thermocycle and use the following PCR protocol:

Step	Temperature (°C)	Time	#cycles
Initial denaturation	98	30 seconds	1
Denaturation	98	5-10 seconds	25-35
Annealing	45-72 (based on Tm)	10-30 seconds	25-35
Extension	72	15-30 seconds/kb	25-35
Final Extension	72	5-10 minutes	1
Hold	12	∞

Protocol adapted from Thermo scientific (Phusion™ High–Fidelity DNA Polymerase).

PCR & DNA Cleanup (NEB Monarch®)

1. Dilute your sample with DNA Cleanup Binding Buffer according to the table below. Mix well by pipetting up and down or flicking the tube. Do not vortex.

Sample type	Ratio binding buffer : Sample
dsDNA > 2kb (plasmids, gDNA)	2:1
dsDNA < 2kb (some amlicons, fragments)	5:1



2. Insert a column into a collection tube and the load sample onto the column.
3. Spin for 1 minute, then discard the flow-through.
4. Re-insert the column into the collection tube. Add 200 μl of DNA Wash Buffer and spin for 1 minute. Discarding flow-through is optional.
5. Repeat step 4.
6. Transfer the column to a clean 1.5 ml microfuge tube.
7. Add ≥ 6 μl of DNA Elution Buffer to the center of the matrix.
8. Wait for 1 minute, then spin for 1 minute to elute the DNA.
9. Determine DNA concentration. Store at -20 °C.

Protocol adapted from New England Biolabs (Monarch® PCR & DNA Cleanup Kit - 5 μg).

Plasmid isolation (Promega PureYield™ Plasmid Miniprep)

1. Transfer 1.5 ml of bacterial culture to sterile 1.5 ml microcentrifuge tube(s).
2. Centrifuge at max speed for 5 minutes. Discard supernatant. Resuspend the pellet in 600 µl of LB media.
3. Add 100 µl of Cell Lysis Buffer (blue), and mix by inverting the tube 6 times.
4. Add 350 µl of cold (4–8 °C) Neutralization Solution, and mix thoroughly by inverting.
5. Centrifuge at maximum speed in a microcentrifuge for 3 minutes.
6. Transfer the supernatant (~900 µl) to a PureYield™ Minicolumn without disturbing the cell debris pellet.
7. Place the minicolumn into a Collection Tube, and centrifuge at maximum speed in a microcentrifuge for 15 seconds.
8. Discard the flow-through, and place the minicolumn into the same Collection Tube.
9. Add 200 µl of Endotoxin Removal Wash (ERB) to the minicolumn. Centrifuge at maximum speed in a microcentrifuge for 15 seconds.
10. Add 400 µl of Column Wash Solution (CWC) to the minicolumn. Centrifuge at maximum speed in a microcentrifuge for 30 seconds.
11. Transfer the minicolumn to a clean 1.5 ml microcentrifuge tube, then add 20 µl of Milli-Q water directly to the minicolumn matrix. Let stand for 1 minute at room temperature.
12. Centrifuge for 15 seconds to elute the plasmid DNA. Determine plasmid DNA concentration. Store at -20 °C.

Protocol adapted from Promega (PureYield™ Plasmid Miniprep System).

RNA isolation (RNAeasy MiniElute)

1. Adjust the sample to a volume of 100 µl with Milli-Q water. Add 350 µl Buffer RLT, and mix well.
2. Add 250 µl of 96–100% ethanol. Mix well by pipetting.
3. Immediately transfer the sample (700 µl) to an RNeasy MinElute spin column placed in a 2 ml collection tube. Centrifuge for 15 seconds at 8000 x g (≥10,000 rpm). Discard the flow-through.
4. Place the RNeasy MinElute spin column in a new 2 ml collection tube and add 500 µl RPE buffer. Centrifuge for 15 seconds at 8000 x g.
5. Discard the flow-through and add 500 µl of 80% ethanol to the RNeasy MinElute spin column. Centrifuge for 2 minutes at 8000 x g.
6. Place the RNeasy MinElute spin column in a new 2 ml collection tube and centrifuge for 5 minutes at full speed.
7. Place the RNeasy MinElute spin column in a new 1.5 ml collection tube and add 14 µl RNase-free water. Centrifuge for 1 minute at full speed, your RNA is now in your tube.

Protocol adapted from Qiagen (RNeasy MinElute Cleanup Kit).

Transformation of chemically competent cells (TOP10)

1. Prepare a heat block at 42 °C.
2. Take an aliquot of TOP10 competent cells (~ 50 µl) from storage at -80 ºC. Thaw on ice for 10-15 minutes.
3. Add 1-100 ng plasmid DNA to the 50 µl of competent cells. Mix by inverting the tube 4-5 times.
4. Incubate on ice for 15 minutes.
5. Heat shock at 42 °C for exactly 45 seconds.
6. Place on ice for 5 minutes.
7. Add 250 µl of SOC medium.
8. Incubate at 37 °C with shaking for 1 hour.
9. Plate 100 µl of the cells on a pre-warmed (at ~ 37 °C) LB agar plate with the desired antibiotic.
10. Incubate at 37 °C overnight. Alternatively, you can incubate over the weekend, leaving the plate on the bench.

DRIVER - in vitro evolution of aptazymes protocols

Sequences: suffixes and prefixes, primers, libraries and references

All the sequences required to conduct DRIVER and the library preparation for sequencing can be found in the file below:

Click here to download the sequences pdf.

DRIVER

The DRIVER protocol for cleavage and uncleavage rounds can be found in the following files:

Click to download the DRIVER protocol for cleavage and uncleavage pdf.

In our experiment we ran four samples in parallel:

Sample name	Library	Ligand in uncleavage rounds (final concentration)
N30-F	T7_W_N30_N6_X	B9 (100 µM)
N30-V	T7_W_N30_N6_X	B1, B6, B12 (100 µM) and B2 (43.2 µM)
N60-F	T7_W_N60_N8_X	B9 (100 µM)
N60-V	T7_W_N60_N8_X	B1, B6, B12 (100 µM) and B2 (43.2 µM)

The use of a positive and a negative control throughout the process is recommended. Our positive control was a fixed sequence with known cleavage properties (gB-Theo), and our negative control a reaction with no-template added:

Control name	DNA template	Ligand in uncleavage rounds (final concentration)
Positive control (PC)	gB-Theo	Theophylline (9.75 mM)
Negative control (NC)	None	Water

The rounds’ order matrix can be found in the spreadsheet below. Starting with two cleavage rounds to remove the sequences that do not cleave. Followed by 60 rounds of cleavage and uncleavage in a 1:1 ratio. The required primers for each round are also specified in the spreadsheet.

Click here to download the spreadsheet pdf.

When the rounds are performed without a liquid handling robot, we recommend to run a denaturing Urea-PAGE gel after every transcription. Check the Urea-PAGE protocol below. An agarose gel after PCR is also recommended in the early rounds. Check general protocol, DNA and RNA electrophoresis.

The source of the reagents used in this protocol can be found here.

Moreover, we created a DRIVER troubleshooting, tips, and tricks guide, which can be found on our contribution page.

Library preparation for sequencing

We sequenced the N30-F and N30-V libraries after 37 rounds (intermediate) and after 62 rounds (final). Here, the final round is used as an example to explain the protocol. The same procedure can be followed for any intermediate round.

For each condition (N30-F final and N30-V final), two independent rounds are performed in the absence (cleavage) or presence (uncleavage) of ligand(s):

Condition	Sample name	Previous round (PCR template)	Sequencing round	Ligand present	Start prefix
N30-F final	N30-F_R63c	62	63 cleavage	No	W
	N30-F_R63u	62	63 uncleavage	Yes	W
N30-V final	N30-V_R63c	62	63 cleavage	No	W
	N30-V_R63u	62	63 uncleavage	Yes	W

Both cleavage and uncleavage rounds follow the DRIVER protocol as described above up to the PCR step. During PCR, both forward primers, BT1285p (W prefix) and BT1510p (Z prefix), are added to amplify the uncleaved components and the cleaved components, respectively. Moreover, at the PCR step, 4 distinct reference sequences similar to the library structure, each with either a W or Z prefix, are spiked-in at a fixed 1.4 pM concentration each. These references allow computation of absolute concentrations of each sequence with each prefix. Additionally, only 5 PCR cycles are to be performed. The PCR sheet in the DRIVER protocols can be substituted with the files below:

Click to download the PCR step sheet for cleavage and uncleavage pdf.

NGS barcode addition through HiFi PCR

1. Dilute each PCR product 10X by adding 225 μl of water, vortex briefly and spin down.
2. Take 100 μl of the diluted PCR products from step 1 and add 3 μl of RNase A. Incubate at 37 °C for 30 minutes to remove any possible RNA contamination.
3. Add the following components in a PCR tube:

Component	Volume (µl)
Milli-Q water	27
Q5 High-Fidelity 2x Master Mix	10
10 µM FW Primer (W1 or W2)	2.5
10 µM FW Primer (Z1 or Z2)	2.5
10 µM RV Primer (X1 or X2)	2.5
10 mM dNTPs	1
DNA Template (after RNase A treatment)	4
Q5 High-Fidelity DNA Polymerase	0.5
Final volume	50




The reverse primer X1 is used to barcode folate samples (N30-F_R63c and N30-F_R63u). The reverse primer X2 is used to barcode vitamin samples (N30-V_R63c and N30-V_R63u). The forward primers W1 and Z1 are used to barcode cleavage samples (N30-F_R63c and N30-V_R63c). The forward primers W2 and Z2 are used to barcode uncleavage samples (N30-F_R63u and N30-V_R63u).

Run 5 μl of the PCR products on an agarose gel to check whether the size of the amplicon is correct. For DNA electrophoresis, check general protocol, DNA and RNA electrophoresis.

Sequencing Library Mixdown

1. Perform a clean-up of the PCR products. For this step, we recommend the PCR and DNA clean up kit 5 μg (Monarch®) from New England Biolabs. Check general protocol, DNA Cleanup (NEB Monarch®). Elute products in 25 μl of Milli-Q water.
2. Quantify products using Qubit® dsDNA HS Assay Kit. For DNA concentration determination using Qubit®, check general protocol, DNA concentration determination: Using Qubit® dsDNA HS Assay Kits.
3. Mix the four samples (N30-F_R63c, N30-F_R63u, N30-V_R63c and N30-V_R63u) in equimolar concentrations.
4. The sample can be sequenced on an Illumina platform. In our case, after the library mixdown, samples were sent to Eurofins Genomics. Sequencing adapters were added via ligation (NGSelect Amplicons Adaptor Ligation). The sample was then sequenced using the Illumina NovaSeq sequencing technology, with 2 x150 bp paired-end reads.

Characterization of aptazyme cleavage fractions through transcription and denaturing PAGE

1. Prepare the following reaction mixture:

Component	Volume (µl)	Final concentration
10X RNA pol buffer	2	1X
rNTPs (25 mM each)	1.8	9 mM
DTT (500 mM)	0.4	10 mM
SUPERase In (20 U/µl)	1	1 U/µl
T7 RNA pol (50 U/µl)	2	5 U/µl
DNA template	X	10 nM
Ligand	Y	Y
Milli-Q water	Z
Final volume	20



2. Incubate at 37 °C for 30 minutes.
3. Stop the transcription and cleavage reactions by adding EDTA to a final concentration of 4 mM.
4. Prepare samples, pre-run, run and stain gel as described in the Urea-PAGE protocol below.

Urea-PAGE

Gel casting

1. Mix the following components in a Duran bottle:

Component	Volume (for 2 gels, 15 ml)	Final concentration
Urea	7.2 g (~ 5.5 ml)	8 M
TBE 10X	1.5 ml	1X
Distilled water	4.2 ml
Acrylamide:Bisacrylamide 29:1 (40%)	3.75 ml	10%



2. Microwave at medium-low power for 15-20 seconds or until all the urea is dissolved. Do not overheat as cyanates may begin to form.
3. Cool down the mixture in the fridge. Ensure that the lid is closed and let it lay sideways on the bottom of the fridge for fast cooling.
4. While waiting for step 3, assemble the gel cassette.
5. Add 150 µl of 10% APS and 7.5 µl of TEMED and mix well. The final mixture has to be cold, otherwise it will polymerize in the bottle and you will not be able to pipette it.
6. Pour/pipette the gel (~ 6 ml per gel). Insert the comb quickly making sure there are no bubbles in the comb.
7. Leave the tip inside the Duran bottle. When the remainder of the solution has polymerized (~ 20-30 minutes), your gel will be ready.
8. Gels can be stored at 4 °C for up to 1 week.

Pre-run

1. Assemble the gel and immerse in TBE running buffer.
2. Remove the comb and carefully rinse the wells with a pipette. You have to see how the urea comes out of the wells.
3. Pre-run the gel at 120 V for 30 minutes. During this time, prepare your samples as described below.
4. Rinse the wells again.

Sample preparation

1. Mix 7.5 µl of RNA sample with 7.5 µl of 2X RNA loading buffer. Incubate at 95 °C for 10 minutes. Spin down before loading onto the gel. Prepare also the ssRNA ladder in the same way during this step.

Run

1. Load the samples into the wells.
2. Run the gel at 220 V until the front goes away (~ 50 minutes).

Gel staining and imaging

1. Immerse the gel in a SYBR Safe staining solution (50 µl SYBR Safe in 50 ml 1X TBE buffer) for 5-15 minutes. The staining solution can be reused, but it must be kept in total darkness to prevent degradation of SYBR Safe.
2. Visualize gel in a BioRad Imaging System.

Vitamin stock solutions

1. Dissolve the required amount of vitamins in Milli-Q water according to the following table:

Vitamin	Vitamin amount (mg)	Milli-Q water (ml)	Final concentration (µM)
Vitamin B1 (Thiamine pyrophosphate)	5.3	10	2000
Vitamin B2 (Riboflavin)	2.7	40	180
Vitamin B6 (Pyridoxal 5′-phosphate)	3.4	10	2000
Vitamin B9 (Folic acid)	8.8	30	664.5
Vitamin B12 (Cobalamin)	6.8	2.5	2000




All vitamins were purchased from Sigma-Aldrich, except for riboflavin that was purchased from ThermoFisher.

2. To dissolve vitamin B9 (folic acid), adjust the pH of the solution to pH 8 using 1 M NaOH.
3. Store the solutions at 4 °C in dark nalgene bottles for up to 1 week.

Cell-free expression system protocols

TnT® SP6 High-Yield Wheat Germ Protein Expression System (Promega)

1. Take TnT® SP6 High-Yield Wheat Germ Master Mix from storage at -80 ºC. Rapidly thaw the master mix on ice or by hand warming, and immediately place on ice.
2. After the master mix has thawed, gently mix several times by pipetting.
3. Assemble the following reaction components in a nuclease-free reaction vessel (e.g. 0.5 ml microcentrifuge tube):

Component	Volume (µl)
TnT® SP6 High-Yield Wheat Germ Master Mix	12
DNA Template (BYDV vector*)	X (0.5-5 nM)
Milli-Q water	Y
Theophylline	Z
Final volume	20

* BYDV vectors incorporate sequences from the barley yellow dwarf virus (BYDV) upstream and downstream of the protein-coding region of interest.

4. Mix gently after all components are added to the reaction tube. Place back on ice.
5. (Optional) Transfer the assembled reaction to a 384-well plate if measurements are to be taken in a plate reader.
6. Incubate the reaction at 25 °C for 2 hours.

Protocol adapted from Promega (TnT® SP6 High-Yield Wheat Germ Protein Expression System).

myTXTL® T7 Expression Kit

1. Take the myTXTL LS70 Master Mix, the helper plasmid P70a-T7rnap and the positive control plasmid T7p14-deGFP from storage at -80 ºC. Rapidly thaw the master mix on ice or by hand warming, and immediately place on ice.
2. Vortex the myTXTL LS70 Master Mix for 2-3 seconds and briefly spin down. If any precipitate is visible hereafter, gently resuspend master mix solution about 10 times to ensure homogeneity. Avoid formation of bubbles and foam.
3. Assemble the following reaction components in a nuclease-free reaction vessel (e.g. 0.5 ml microcentrifuge tube):

Component	Volume (µl)
Sigma 70 Master Mix	15
P70a-T7rnap HP (2.4 nM)	0.83
DNA Template	X (0.5-5 nM)
Milli-Q water	Y
Final volume	20

4. Mix gently after all components are added to the reaction tube. Place back on ice.
5. (Optional) Transfer the assembled reaction to a 384-well plate if measurements are to be taken in a plate reader.
6. Incubate the reaction for up to 16 hours at 29 °C.

Protocol adapted from Arbor Biosciences (myTXTL® T7 Expression Kit).

PURExpress® In Vitro Protein Synthesis Kit

1. Take solutions A and B from storage at -80 °C, and thaw on ice.
2. Pulse-spin in microfuge to collect solutions at the bottom of the tube. Certain components in Solution A may precipitate during storage. Be sure to mix it well by pipetting prior to assembling reactions. Do not vortex solution B.
3. Assemble the following reaction components in a nuclease-free reaction vessel (e.g. 0.5 ml microcentrifuge tube):

Component	Volume (µl)
Solution A	8
Solution B*	6
SUPERase•In™ RNase Inhibitor (20 U/μl)	0.5
CPRG (10.9 mg/ml)**	1.11
DNA Template	X (0.5-5 nM)
Milli-Q water	Y
Theophylline	Z
Final volume	20

*Add Solution B to Solution A, do not dilute Solution B unbuffered

**To prepare a 10.9 mg/ml CPRG stock solution, weigh 10.9 mg of CPRG and dissolve it in 1 ml of Milli-Q water. Make aliquots of the solution and store at -20 °C. When preparing a PURExpress® In Vitro Protein Synthesis reaction, thaw a CPRG aliquot on ice and wrap it in aluminum foil. Discard the remainder of the solution, do not reuse it.

4. Mix gently and pulse-spin in microfuge to collect mixture at the bottom of the tube.
5. (Optional) Transfer the assembled reaction to a 384-well plate if measurements are to be taken in a plate reader.
6. Incubate the reaction at 37 °C for 2 hours.

Protocol adapted from New England Biolabs (PURExpress® In Vitro Protein Synthesis Kit).

PUREfrex® 2.0

1. Take solutions I, II and III from storage at -80 ºC, and thaw on ice.
2. Pulse-spin in microfuge to collect solutions at the bottom of the tube. Vortex solution I to ensure proper mixing. Gently mix solutions I and II by pipetting. Solutions II and III should not be vortexed.
3. Assemble the following reaction components in a nuclease-free reaction vessel (e.g. 0.5 ml microcentrifuge tube):

Component	Volume (µl)
Solution I	10
Solution II	1
Solution III	2
SUPERase•In™ RNase Inhibitor (20 U/μl)	0.5
DNA Template	X (0.5-5 nM)
Milli-Q water	Y
Theophylline	Z
Final volume	20

4. Mix gently and pulse-spin in microfuge to collect mixture at the bottom of the tube.
5. (Optional) Transfer the assembled reaction to a 384-well plate if measurements are to be taken in a plate reader.
6. Incubate the reaction at 37 °C for 2 hours.
7. If X-Gal is used as substrate, add it to a final concentration of 10 mg/ml. Let the reaction proceed overnight at room temperature.

Protocol adapted from GeneFrontier (PUREfrex®2.0).

Cell-free system reactions in paper discs

Paper discs preparation

1. Cut 4 mm paper discs (Whatman, 1442-042) using a hole puncher.
2. Place the discs in a glass petri dish.
3. Sterilize by autoclaving.

Cell-free system reaction assembly

1. In sterile conditions, place a disc in the wall of a 1.5 ml microcentrifuge tube.
2. Assemble the following reaction components in a nuclease-free reaction vessel (e.g. 0.5 ml microcentrifuge tube).



Using PURExpress® In Vitro Protein Synthesis Kit:

Component	Volume (µl)
Solution A	3
Solution B	2.25
SUPERase•In™ RNase Inhibitor (20 U/μl)	0.2
CPRG (10.9 mg/ml)	0.412
DNA Template	X (0.5-5 nM)
Milli-Q water	Y
Final volume	7.5




Or using PUREfrex® 2.0:

Component	Volume (µl)
Solution I	3.75
Solution II	0.375
Solution III	0.75
SUPERase•In™ RNase Inhibitor (20 U/μl)	0.2
CPRG (10.9 mg/ml)	0.412
DNA Template	X (0.5-5 nM)
Milli-Q water	Y
Final volume	7.5



3. Carefully transfer the mixture to the paper disc.
4. Do not close the lid of the 1.5 ml microcentrifuge tube, but cover the tube with parafilm. Make holes in the parafilm lid. Wrap the tube in aluminum foil to avoid CPRG degradation.
5. Put all your 1.5 ml microcentrifuge tubes in a box and wrap the box in aluminum foil.

Lyophilization

1. Freeze the samples at -80 °C for two hours.
2. Lyophilize the samples overnight according to manufacturer instructions (Alpha 1–4 LD Plus).
3. After lyophilization, keep the paper discs at room temperature until use.

Rehydration of paper discs

1. Transfer the discs to a 96-well plate in sterile conditions.
2. Rehydrate the paper discs with the desired concentration of ligand or Milli-Q water to the original reaction volume (7.5 µl).
3. Incubate at 37 °C for 2 hours.

Hardware protocols

Paper discs preparation

1. Cut 4 mm paper discs (Whatman, 1442-042) using a hole puncher.

Food color preparation

1. Dilute the food colorant in 1.5 ml tubes with Milli-Q water to lower the concentration (0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, concentrations normalized by the undiluted concentration).

CPR preparation

1. Dilute the CPR in 1.5 ml tubes with Phosphate Buffered Saline (PBS) (10x) to lower the concentration (0.5 mM, 0.75 mM, 0.3 mM, 0.4 mM, 0.5mM, 0.6 m, 0.7 mM, 0.8 mM, 0.9 mM, 1 mM).

Loading on the Hardware

The samples are either loaded on the test cassette of the hardware or on a 96-well plate for the plate reader.

1. Clean the wells of the test cassette with Milli-Q-water if a disc with food colorant is loaded, and Phosphate Buffered Saline (PBS) (10x) if a disc with CPR is loaded.
2. Use a tweezer to load the 4 mm paper disc in the wells of the test cassette.
3. Pipette 5.5 µL of the sample onto the paper disc.
4. Slide the test cassette into the hardware.
5. Measure the light intensity for 60 seconds.

Plate reader

The samples are either loaded on the test cassette of the hardware or on a 96-well plate for the plate reader.

1. Load the paper discs in a 96-well plate
2. Pipette 5.5 µL of the sample onto the paper disc.
3. Measure the absorbance of the paper discs at a wavelength of 574 nm, or the absorbance spectrum from 300 to 1000 nM.

Electrophoretic Mobility Shift Assay protocols

Sequences: DNA & RNA oligos

Sequences were generated and provided by the Vilnius iGEM team 2021, using their surface interactions aptamer prediction software:

Oligonucleotide	Description	Sequence
RBP4_ssD	30 nucleotides ssDNA oligo predicted to bind to the human retinol binding protein 4	GTTGATTGTTATGTTTAGTGACGGGTTCCC
Rand_ssD	30 nucleotides random ssDNA oligo used as a negative control for binding	AGGGTCACATGGGCGTTTGGCACTACCGAC
RBP4_RNA	30 nucleotides RNA oligo predicted to bind to the human retinol binding protein 4	GUCCCCCGCCCGUGUCCCGCUAGCCCCGCG
Rand_RNA	30 nucleotides random RNA oligo used as a negative control for binding	CUGUUUUCGAAAUUACCCUUUAAGCGCGGG

All oligonucleotides were synthesized by Integrated DNA Technologies.

Working RNase free

1. Before starting to work: Wash hands and wrists thoroughly. Dry with a paper towel. Put gloves on.
2. Pick a designated area for RNase free work. Only materials involved in the RNase free experiment must be introduced in this area, after being treated for RNase free work.
3. Clear working space of all materials and equipment. Clean bench surface with ethanol 70% and a paper sheet. Afterwards clean the bench surface with RNAzap spray and paper sheet.
4. Clean pipettes stand with ethanol 70% and introduce it in the RNase free working space.
5. Wet a paper sheet with 70% ethanol and clean pipette with it. Spray RNAzap onto a new paper sheet and clean the pipette with it. Pipette can then be placed on the pipette holder. Repeat for every pipette using the same RNAzap paper sheet.
6. Clear the outer surface of every material and equipment to be directly handled and held while working with RNase sensitive samples, using a paper sheet sprayed with RNAzap. Place all clean material inside the RNase free zone within reaching distance.
7. Before beginning work: Change gloves and spray a small amount of RNAzap. Rub hands to cover the gloves surface on the RNAzap.
8. When working in the RNase free zone: Avoid talking or otherwise use a facemask.
9. Do not touch face, skin, clothes, or any surface nor materials outside of the RNase free zone or that have not been treated against RNases. If any contamination of the hands were to happen, clean gloves with RNAzap.

Native PAGE

1. Mix the following components in a Duran bottle (for 2 gels, 15 ml).



Component	Volume (ml)	Final concentration
Acrylamide:Bisacrylamide 29:1 (40%)	3.75	10%
TBE 10X	1.5	1X
Distilled water	9.6



2. Let the mixture cool down in the fridge in order to retard polymerization upon addition of the next components.
3. Add 150 µl of 10% APS and 7.5 µl of TEMED and mix well.
4. Rapidly swirl container to assure mixture of the components and immediately use 1 ml pipette to pour the mixture into the glass cassettes. Quickly insert the comb, making sure no bubbles remain under the comb.
5. Leave the tip inside the Duran bottle. When the remainder of the solution has polymerized (~ 20-30 minutes), your gel will be ready.

Oligonucleotides visualization

Sample preparation

1. Resuspend oligonucleotides in required buffer (usually TE) or in Milli-Q water, as specified by the manufacturer.
2. Prepare further dilutions of the oligonucleotides as required.
3. Prepare ssRNA or ssDNA ladders. For preparation of the ssRNA ladder, mix RNA ladder with 2X RNA loading buffer in a 1:1 ratio (final volume 4 µl). Incubate at 95 °C for 10 minutes. Cool on ice for 3 minutes. For preparation of oligo standards ladder dilute ladder 1:1 with 50% glycerol and incubate at 95 °C for 10 minutes. Cool on ice for 3 minutes.
4. Prepare samples for loading into gels by diluting with Milli-Q water to the required concentration. Keep samples on ice.

Gel electrophoresis

1. Assemble gel electrophoresis casette and pre-run gel at 120 V for 20 minutes.
2. Dilute samples to a 1:1 ratio using 50% glycerol stock solution. If working with ssDNA ladder, dilute in the same way. Mix by vortex and spin down.
3. Load ssDNA or ssRNA ladder into the first well of the gel. Load 15 µl of each sample into the wells of the gel.
4. Run PAGE at 120 V for 50 minutes. Wait for the tracking dye to be ¾ in the gel.

Gel staining and visualization

1. Recover gel and stain in SYBR Safe (50 µl SYBR Safe in 50 ml 1X TBE buffer) for approximately 15 minutes.
2. Visualize gel in a BioRad Imaging System.
3. Identify suitable concentration of oligonucleotides for proper visualization.

EMSA

Binding Buffer preparation

1. Prepare a binding buffer 5X stock as indicated in the following table

Component	Volume (µl)	Final concentration
PBS buffer 10X	250	5X
MgCl2 1 M	2.5	5 mM
KCl 1M	30	60 mM
Glycerol 80%	156.25	25%
Milli-Q	61.25	-
Final volume	500	-



2. Aliquote into working samples and store at -20 °C.

Sample preparation

1. Prepare a master mix as indicated in the following table

Component	Volume (µl) 1 reaction	Volume (µl) 10 reactions	Final concentration
Binding buffer 5X	2	15	1X
DTT 10 mM	0.075	0.75	0.1mM
BSA 1 mg/ml	0.075	0.75	0.01 mg/ml
Final volume	1.65	16.5	-



2. In PCR tubes, add oligonucleotides (50 ng) and target protein in equimolar ratios (1:0, 2:0.5, 1:0.5, 1:1, and 1:2).
3. Fill up to 5.85 µl with Milli-Q water.
4. Add 1.65 µl of master mix to each of the tubes.
5. Incubate at 37 °C for 45 minutes.
6. Prepare ssRNA or ssDNA ladders. For preparation of the ssRNA ladder, mix RNA ladder with 2X RNA loading buffer in a 1:1 ratio (final volume 4 µl). Incubate at 95 °C for 10 minutes. Cool on ice for 3 minutes. For preparation of oligo standards ladder dilute ladder 1:1 with 50% glycerol and incubate at 95 °C for 10 minutes. Cool on ice for 3 minutes.

Gel electrophoresis

1. Assemble gel electrophoresis casette and pre-run gel at 120 V for 20 minutes.
2. Dilute samples to a 1:1 ratio using 50% glycerol stock solution. If working with ssDNA ladder, dilute in the same way. Mix by vortex and spin down.
3. Load ssDNA or ssRNA ladder into the first well of the gel. Load 15 µl of each sample into the wells of the gel.
4. Run PAGE at 120 V for 40 minutes. Wait for the guiding dye to be ¾ in the gel.

Gel staining and visualization

1. Stain in SYBR Safe (50 µl SYBR Safe in 50 ml 1X TBE buffer) for approximately 15 minutes.
2. Visualize gel in a BioRad Imaging System.

Microfluidic chip printing protocols

Printing microfluidic channels

1. Create your desired shape template. To this, you can use, for example, Microsoft powerpoint.
2. Print out the template on A4 paper.
3. Use masking tape to attach 5 chromatography papers (Whatman qualitative filter paper, Grade 1 175x100 mm) to A4 template.
4. Print microfluidic channels on the Whatman paper.
5. Print settings:
   
   
   • Resolution: 1200 dots per inch (dpi)
   • Printer: Xerox AltaLink C8055
   
   
6. Remove the masking tape.

Impregnating the ink

1. Preheat oven at 165 °C.
2. Put the papers in a glass container that can withstand 165 °C.
3. Keep the container in the oven for 15 minutes.
4. Carefully take it out of the oven and let it cool.

Testing the chip

Pipette 40 µl of food coloring onto the microfluidic paper chip.

A big thank you to our sponsors!