Proof of concept

Contact

Proof of Concept

Method development

Four strains of bacteria were selected among a list of candidates for production of promising amounts of keratinases KerBIMKU3 [1] (BBa_K3895005), KerBteQ7 [2] (BBa_K3895006), KerBIER15 [3] (BBa_K3895004), and KerAvDZ50 [4] (BBa_K3895003).

After transformation of PET 28a(+) - ker plasmids into E.coli BL21 (DE3), DNA of each keratinases was amplified by PCR and sequenced for verification. The protein will not be expressed unless Isopropyl β-D-thiogalactoside (IPTG) was added for induction. The Protocol for His-tag purification was developed after disrupting the bacterial cells by ultrasonication to separately obtain the four purified keratinases. Moreover, the purified protein was ultrafiltrated to be condensed for the following use and tests.

Keratinases were compared for their functions and activities in both qualitative and quantitative tests to ensure the effect for future depilatory application. Before enzyme activity tests, protein concentrations were determined via the BCA kit. The ones with the best performance were further applied on real porcine hair and also on cut human hair. After that, different mediums including cream, gel and etc. ought to be used for further testing of enzyme activity. According to the advice given by the skincare experts from COTY beauty during our Human Practice activity, the hydrogel was finally adopted as the depilatory medium.

Plasmid construction

The optimized sequences of four keratinases KerBIMKU3 (BBa_K3895005), KerBteQ7 (BBa_K3895006), KerBIER15 (BBa_K3895004), and KerAvDZ50 (BBa_K3895003) were constructed into PET 28a (+) plasmids separately, which contains kanamycin resistance genes for colony selection and lacI for IPTG induction.

The four plasmids: kerBlMKU3_dna_pET-28a(+) (BBa_K3895010), kerBteQ7_dna_pET-28a(+) (BBa_K3895007), kerBlER-15_dna_pET-28a(+) (BBa_K3895008), and 2_kerAvDZ50_dna_pET-28a(+) (BBa_K3895009) were transformed into E.coli BL21 (DE3) according to the Protocol. PCR was conducted first for verification of the correct plasmids (Figure 2.a). Then the amplified DNAs were sequenced (forward primer: TCGATCCCGCGAAATTAATACG; reverse primer: AGGGGTTATGCTAGTTATTGCTCA) and compared with the designed DNA sequences for further verification.

Figure 1. Plasmid construction of the four keratinases.

Protein Purification

Two iterations of purification methods were developed: using Ni-risen for centrifugation or Ni-NTA Beads 6FF Gravity Column for purification. Through trial and error, the most effective method was developed from the two methods, and has been evaluated based on several aspects including efficiency, practicality, and simplicity. SDS-PAGE was used to verify the composition and protein sizes from each elution (Figure 2.b).

Figure 2. (a) PCR and gel electrophoresis to verify the success of transformation. The results showed lengths of DNA were around 1300bp, which was around the designed length of DNA. (b) SDS-PAGE of the 4 keratinases. Protein molecular marker; Lane1. Empty PET-28a vector; Lane2. The crude enzyme (kerBlER15); Lane3. The crude enzyme (kerAvDZ50); Lane4. The purified enzyme (kerBlER15); Lane5. The purified enzyme (kerAvDZ50); Lane6. Empty PET-28a vector; Lane7. The crude enzyme (kerBlMKU3); Lane3. Crude enzyme (kerBteQ7); Lane8. The purified enzyme (kerBlMKU3); Lane5. The purified enzyme (kerBteQ7).

Effectiveness verification of keratinases

Quantitative testing

To verify the protease effect, the 4 types of keratinase were tested using natural protein substrates (casein, gelatin, BSA, hair) [5, 6] and synthetic proteins (azocasein) [7,8]. The detailed measurement results can be found in Measurements section.
Before testing the enzyme activity, the concentration of the 4 enzymes after extraction and ultrafiltration and concentration should be determined using the BCA kit, so that their effects can be compared based on relatively consistent concentrations.

Figure 3. Protein concentrations of 400 times dilutes of the 4 ultrafiltrated keratinases calculated based on BCA standard concentration curve. The original concentration was calculated and corrected to 100 mg/ml.

	Enzyme concetration (mg/ml)	Correction coefficient (to 100 mg/ml)
KerBIMKU3 ori	94.5	0.95
KerAVDZ50 ori	139.73	1.4
KerBteQ7 ori	91.6	0.92
KerBIER15 ori	191.55	1.92

Table 1. Concentration and correction coefficient of the 4 kratinases, determined according to the BCA standard concentration curve.

For the same concentration of natural substrates (casein, gelatin and BSA), different concentration gradients of the 4 keratinases were used for degradation to compare one or two out of the four enzymes with better effect (Figure 4).

Figure 4. Protease activity of 4 keratinases on different natural substrates at 30 min of incubation, pH 7.5. The degree of action of keratinase on the substrate is in the order of BSA, casein, and gelatin, OD (A660) detected via Folin-Ciocalteu's phenol reagent. KU3, Z50 and Q7 all showed a relatively high enzyme activity among 4 keratinases at a higher concentration (100mg/ml) on the three substrates (casein, BSA and gelatin). Whereas, the activity of Z50 is relatively lower at a lower concentration (<50 mg/ml), compared with KU3 and Q7.

For a suitable working environment for human skin, it was defined that the unit of protease activity was defined as the amount of enzyme required to yield an increase in absorbance (A660) of 0.01 in 30 min at 37°C. The results of the four proteins were compared side by side. It can be clearly found that among the three substrates, the degradation effect of keratinase on 0.1% casein is more obvious than that of 1% gelatin. While for BSA, a concentration of 0.1%w/v which fell within the effective rang of detection via the Folin-Ciocalteu's phenol reagent, resulted in an activity higher than 0.1% casein. And at higher concentrations, KU3 and Q7 showed relatively higher degradation. The effect of R15 is not very obvious whether it is at a comparably higher concentration or a lower concentration, and the effect does not change much. Hence, KU3 and Q7 were selected for further modelling and quantitative testing to verify keratinase activity.

According to the data summarized from Human Practice research, consumers' general demands for hair removal products are that they hope that hair removal can be finished in a short time, so the experiment was designed to focus on the comparison of the effects in the first 30 minutes of the investigation. In order to study the length of time that keratinase can remain active, other time gradients (12 h, 24 h, 36 h etc.) were also set within 2 days.

Figure 5. Activity of 3 ml of 100 mg/ml KU3 and Q7 on 1 mg of human hair. In the first 30 minutes, both enzymes showed a rapid increase in activity, and then continued to rise slowly until about 12 hours before began to decrease.

Qualitative testing

Data of keratinases on both natural and artificial substrates all showed that the effect of the KU3 enzyme is the most obvious. More experiments were done by observing the hair condition after keratinase treatment under the microscope and compared it with the chemical degradation process to intuitively show its hair removal effect (Figure 6 ). It is obvious that, compared to the blank with buffer, samples treated with either KU3 or Q7 showed gradient degradation effect along with time. Positive control was set up using chemical reagent dithiothreitol (DTT). The results indicated a different degradation manner between keratinases and DTT. Furthermore, the structure of hair had been loosen by DTT, whereas hair sample treated by both KU3 and Q7 were cracked at the end of experiment, especially under the effect of the combination of these two enzymes.

Figure 6. Comparison of the degradation of human hair in keratinase solution and chemical substances under the microscope. It can be clearly observed that the hair breaks during the degradation process

Figure 7. Comparison of hairy pigskin treated with 12h (b) and 24h (c) keratinase KU3 and Q7 and chemical reagent DTT before and after.

Finally, to test our product, porcine skin with hair was used as the polymers present in the fine hairs resemble that of human hairs and to ensure our experiments remain ethical. After 12 hours of incubation treatment, the surface of pigskin has obvious changes. Even compared with chemical reagents like dithiothreitol (DTT), the cuticle treated with keratinase is softer, and it is easy to scrape off the hair.

In addition to taking pictures of the treated epidermis for comparison, the shaved hair was also compared under a microscope. For the control group, because it was difficult to shave off, the hair was shaved off with a spatula and observed.

Figure 8. The state of the hair on the porcine skin treated with keratinase and chemical reagents under the microscope. Obviously, the degradation effect of KU3 is very significant, and the working method of chemical reagents is different from that of enzymes. The result is that the hair becomes thinner, and the keratinase breaks the disulfide bonds in the hair structure.

Hydrogel Packaging

The effects our product has on the hairs can be observed and it is both cosmetically viable and potentially efficient for other uses such as removing keratin waste from hard-to-reach areas. The team is still improving the enzyme activity test data and will prepare porcine skins with hair to verify the actual effect of hair removal cream, compared to similar products at the same time.

After obtaining considerable data, we worked with the NDNF team to hydrogel [16] package the protein with significant effects to prove its feasibility in actual production. Data shows keratinase can maintain activity in the hydrogel for at least 24h, though further conditions for preservation needs to be testified. Both keratinases KU3 and Q7 maintained a comparably higher enzyme activity within the hydrogel capsule than common preservation in Tris buffer. The specific product presentation can be found in the implementation part.

Figure 9. Enzyme activity obtained from keratinase encapsulated in hydrogel and stored for 1 day. Keratinase stored at room temperature is not easy to preserve due to hydrogel cracking; while keratinase stored at low temperature is still intact in the hydrogel and its activity can be maintained

Our next step involved analyzing the efficiency of the enzymes in other media besides hydrogel, and modeling the behavior using the Michaelis-Menten equation and Response surface mentioned in the Model section. This allowed us to effectively compare the suitability of the different product media we have. We are still working on predicting the behavior of combining multiple enzymes since for the most effective product, it shouldn't only be useful in a limited number of situations.

References

Elhoul, M. B., et al. (2016). "Biochemical and molecular characterization of new keratinoytic protease from Actinomadura viridilutea DZ50." International journal of biological macromolecules 92: 299-315.
Radha, S. and P. Gunasekaran (2007). "Cloning and expression of keratinase gene in Bacillus megaterium and optimization of fermentation conditions for the production of keratinase by recombinant strain." Journal of applied microbiology 103(4): 1301-1310.
Tiwary, E. and R. Gupta (2010). "Extracellular expression of keratinase from Bacillus licheniformis ER-15 in Escherichia coli." Journal of agricultural and food chemistry 58(14): 8380-8385.
Jaouadi, N. Z., et al. (2015). "A novel keratinase from Bacillus tequilensis strain Q7 with promising potential for the leather bating process." International journal of biological macromolecules 79: 952-964.
Cupp-Enyard, C. (2008). "Sigma's non-specific protease activity assay-casein as a substrate." JoVE (Journal of Visualized Experiments)(19): e899.
Palmer, M. (1993). "A gelatin test to detect activity and stability of proteases produced by Dichelobacter (Bacteroides) nodosus." Veterinary microbiology 36(1-2): 113-122.
McCleary, B. V. and D. Monaghan (2000). New developments in the measurement of alpha-amylase, endo-protease, beta-glucanase and beta-xylanase. VTT SYMPOSIUM, VTT; 1999.
Coêlho, D. F., et al. (2016). "Azocasein substrate for determination of proteolytic activity: Reexamining a traditional method using bromelain samples." BioMed Research International 2016.

Team:SZ SHD/Proof Of Concept