Team:SZ SHD/Engineering
Engineering Success
The improvement and iterative steps of hair removal product research and development are shown here, echoing the various modules of the Proof of Concept part. Detailed methodology is recorded in the Protocol section, and results are recorded in the Measurement section.
1. Keratinase selection
Investigations led the project to the promising discovery that certain strains of Bacillus produced a variety of keratinases (Table 1).
| Accession number | Original strain | Optimum pH | Optimum temperature/℃ | Special conditions |
|---|---|---|---|---|
| N/A | Bacillus subtilis KS-1[1] | N/A | N/A | Dithiothreitol enhanced keratinolytic activity by 1.6 times at a concentration of 5.0 mM. |
| N/A | Bacillus cereus PCM 2849[2] | N/A | N/A | N/A |
| AY157745 | Chryseobacterium sp. kr6[3] | 8.5 | 50 | N/A |
| N/A | Bacillus subtilis CH-1[4] | N/A | N/A | Four kinds of enzymes which include extracellular protease Vpr, peptidase T, g-glutamyl transpeptidase and glyoxalmethylglyoxal reductase were identified as having principal roles. |
| N/A | Bacillus sp. MG-MASC-BT [5] | 8 | 60 | N/A |
| N/A | Bacillus cereus LAU 08[6] | 7 | 50 | N/A |
| DQ071570 | Bacillus licheniformis MKU 3[7] | N/A | N/A | N/A |
| MT268133 | Bacillus sp. Nnolim-K1[8] | 8 | 60 | N/A |
| JX504681 | Bacillus licheniformis BBE11-1[9] | 10.5 | 40 | Stable at 10-50℃ and pH 7-11.5 |
| FJ619651 | Bacillus pumilus A1[10] | 9 | 60 | N/A |
| KX184831 | Bacillus pumilus C4[11] | 7.0-11.0 | N/A | N/A |
| KX184832 | Bacillus pumilus C4[12] | 7.0-11.0 | N/A | N/A |
| KP694221 | Bacillus tequilensis Q7[13] | 7 | 30 | N/A |
| JN859581 | Bacillus licheniformis S90[14] | 7.5 | 50-60 | N/A |
Table 1. Some bacteria that can secrete keratinase in mild pH and temperature conditions for human skin.
The enzymes were evaluated based on several characteristics: optimum working temperature, optimum working pH, as well as their induction time and conditions. Since this product was developed to be used on human skin, the enzyme needs to properly function under conditions that matched skin epidermis. It meant that the enzyme has to have an optimum pH of approximately 4.5 to 7.5 and an optimum functioning temperature of around 37°c.
The feasibility of our experiment also had to be considered. Short induction time and similar conditions between each keratinase such as incubation temperature is essential for the experiment. Similar conditions for induction will allow the different keratinase experiments to run simultaneously and short induction time will allow experiments to quickly be repeated or modified, improving the efficiency.
4 specific types of enzymes were indicated to be potential candidates – KerBIMKU3, KerBteQ7, KerBIER15, KerAVDZ50. It was decided that 4 candidates would mean that there is a greater chance that an efficient keratinase could be synthesized.
2. Design of plasmids
Sequences of the four keratinases KerBIMKU3 (BBa_K3895005), KerBteQ7 (BBa_K3895004), KerBIER15 (BBa_K3895006), and KerAvDZ50 (BBa_K3895003) were constructed using SnapGene.
The keratinases were originally from Bacillus, while E.coli as a model organism was used for expression. 6x His-tags were added to the ends of keratinase coding sequences for purification purpose. All four sequences were then optimized for E.coli expression, with the avoided restriction sites of BamHI, EcoRI, PstI, SpeI, and XbaI.
A wide variety of factors regulate and influence gene expression levels, including but not limited to codon usage, GC-content, mRNA secondary structure of the genes, cis-acting mRNA destabilizing motifs, RNase splicing sites, and repetitive element. Detailed optimization documents can be checked in the Part section.
To ensure the correct transformants, PCR and gel-electrophoresis were conducted first for verification of the plasmids. Since the detailed information was still unclear only using gel electrophoresis, then the amplified DNAs were sequenced (forward primer: TCGATCCCGCGAAATTAATACG; reverse primer: AGGGGTTATGCTAGTTATTGCTCA) and compared with the designed DNA sequences for further verification. Positive results suggested the induction of protein could be subsequently done.
3. Improvement of Purification
Induction
IPTG induction is required in order for E.coli to express proteins. Being one of the major components of keratinase, it was necessary to find suitable induction conditions such as incubation temperature, induction time, as well as IPTG concentration. Whilst reading through articles, the approximate conditions were finalized (Table 2).
| Name of bacteria | IPTG volume/ul (200ml) | Temperature/°C | Time/h | |
|---|---|---|---|---|
| KerBteQ7 | 1000 | / | 12 | Or 16°C，16h of induction for all |
| KerAVDZ50 | 134.278 | / | 12 | |
| KerBIER15 | 83.92 | 37 | 16 | |
| KerBIMKU3 | 80 | 37 | 4 |
Table 2. Suitable induction conditions for IPTG induction.
Sonification
Isopropanol and phenylmethylsulfonyl fluoride (PMSF) were added to the buffer to prevent bubbling and protein degradation. While it was verified the keratinases were completely inhibited by PMSF because they belongs to the serine keratinase family according to Modeling. Hence it was not suggested to add PMSF during sonication if activity tests would be done later.
Purification
Purification was firstly conducted using Ni-Resin via centrifugation. While Ni-resin was not pre-compressed and assembled in the tube, as a result, every step of centrifugation will lead to a lot of loss. The method of Ni-Risen beads requires less attention and is relatively low maintenance. Purification can be done by simply shaking the beads with the protein solution for several hours then washing. The entire process only requires a stabilized shaker and an icebox. The entire purification process can be done in a thermostatically controlled environment such as a polystyrene icebox, which means that it can protect the activity of the enzymes to the highest degree.
Figure 1. Diagram illustrates the purification process by Ni-Resin.
The iterated version of purification relied on Ni-NTA beads and gravity columns. In this method, Ni-NTA beads were pre-compressed in the gravity column so that the resin will not be suspended during the process. The drawback was that the whole process was very time-consuming, since only when droplets fall naturally by gravity can they be collected.
Figure 2. Diagram illustrates the purification process by Ni-NTA beads 6FF gravity column.
Since the purified protein was aimed to be tested for keratinase activity, a large amount of protein was needed. While according to SDS-PAGE results, though higher purity was obtained after purification, the the amount of purified protein was comparably lower than expected, even after ultrafiltration (Figure 3 and Figure 4). There are also good results, that is, the purity of the crude enzyme (of which the original concentration was 90 mg/ml) is also very high, which was around 40 kDa (Figure 5). It was suggested the crude enzyme could be utilized for activity tests.
Figure 3. Concentration of ultrafiltrated purified Q7 protein.
The concentrations of 2 tested samples were 0.1561 mg/ml and 0.189 mg/ml, which were not enough for the activity tests.
Figure 4. SDS-PAGE of ultrafiltrated purified protein. Lane1. Protein molecular marker; Lane2. KerBIMKU3 Bacteria before induction; Lane3.KerBIER15 Bacteria before induction; Lane4. The supernatant of dilute KerBIMKU3 Bacteria obtained after filtration through Ni-Resin; Lane5. The supernatant of dilute KerBIMKU3 Bacteria was obtained after Wash Buffer; Lane6. The supernatant of dilute KerBIMKU3 Bacteria obtained after Elute Buffer; Lane7. The supernatant of dilute KerBIER15 Bacteria obtained after filtration through Ni-Resin ; Lane8. The supernatant of dilute KerBIER15 Bacteria obtained after Wash Buffer; Lane9. The supernatant of dilute KerBIER15 Bacteria obtained after Elute Buffer; Lane10. The supernatant of KerBIMKU3 Bacteria obtained after filtration through Ni-Resin; Lane11. The supernatant of KerBIMKU3 Bacteria obtained after Wash Buffer; Lane12. The supernatant of KerBIMKU3 Bacteria obtained after Elute Buffer; Lane13. The supernatant of KerBIER15 Bacteria obtained after Filtration through Ni-Resin; Lane14. The supernatant of KerBIER15 Bacteria obtained after Wash Buffer; Lane15. The supernatant of KerBIER15 Bacteria obtained after Elute Buffer.
Figure 5. SDS-PAGE of crude enzymes. Protein molecular marker; Lane1. 10 times dilute of crude enzyme (kerBIMKU3); Lane2. 100 times dilute of crude enzyme (kerBIMKU3); Lane3. kerBIMKU3 bacterial solution before induction. Lane4. 10 times dilute of crude enzyme (kerAvDZ50); Lane5. 100 times dilute of crude enzyme (kerAvDZ50); Lane6. kerAvDZ50 bacterial solution before induction; Lane7. 10 times dilute of crude enzyme (kerBlER15); lane8. 100 times dilute of crude enzyme (kerBlER15); Lane9. kerBlER15 bacterial solution before induction; Lane10. 10 times dilute of crude enzyme (kerBteQ7); Lane11. 100 times dilute of crude enzyme (kerBteQ7); Lane12. kerBteQ7 bacterial solution before induction.
Figure 6. Concentration 400 times dilutes of the 4 ultrafiltrated crude enzymes without purification.
4. Sufficiency and necessity of activity testing
Quantitative
Protease activity
The quantitative experiment was designed to determine the concentration of the protein obtained after expression and ultrafiltration, and to compare keratinase activities in parallel based on the corresponding concentration. Details of data plots can be found in the Measurement section.
Figure 7. Keratinase activity assay of KU3, Z50 and R15 on 0.1% azocasein (0.1 g/100ml).
At the first stage, the concentration of protein was not determined while tested for activity on a known concentration of substrate. The diluted enzyme was treated with azocasein and examined for OD (A440), though the results showed the activity, since the original concentration was not clear, it was hard to quantify. On this basis, concentration measurement was added in Step1.
Step 1. Determination of protein concentration using BCA kit.
Step 2. Protease activity tests of 4 keratinases: KU3, Q7, Z50, and R15
This step uses:
① Azocasein
② Casein, gelatin, hair
respectively as artificial and natural substrates. A concentration gradient of substrate was set up:
0.05, 0.1, 0.5, 1 %w/v for azocasein
o.1, 0.5, 1, 1.5 %w/v for casein and gelatin.
One unit of protease activity was defined as the amount of enzyme required to yield an increase in absorbance (A440 for azocasein and A660 for casein and gelatin) of 0.01 in 30 min at 37°C.
Two out of four keratinases (KU3 and Q7) have shown comparably significant degradative function. While for the other two, especially R15, there is no significant activity indicated by OD value, hence were not chosen for further study.
Step 3. Hydrogel packaging of selected keratinase: KU3 and Q7
Since supported by quantitative tests, these two enzymes have shown apparent keratinase function,KU3 and Q7 were used as the next step of R&D to carry out packaging material testing.
Keratinase activity
The mechanism by which microorganisms degrade keratin varies, so the product during degradation is not the same. Keratinase actually has the activity of polypeptide hydrolase and disulfide reductase. The degradation process of keratinase is often divided into three steps, namely denaturation, hydrolysis, and transamination. First, the disulfide reductase acts on the keratin disulfide bond to reduce cystine (-S-S-) to cysteine (-SH), forming degenerative keratin protein. Then it is gradually hydrolyzed into polypeptides, oligopeptides, and free amino acids by the action of polypeptide hydrolase. Finally, ammonia and sulfide are produced by transamination to completely hydrolyze keratin.
5,5’- dithiobis (2 nitrobenzoie acid) (DTNB) was used to quantify the amount of -SH converted from -S-S-, then OD (412) was examined to calculate the concentration according to the following equations:
C0=(A/ε)*D
of which A= abs at 412 mu; ε=13600/M/cm (extinction coefficient); D=dilution factor
Eg. C0=(A/13600)*(10/x)*[(x+0.02)/x]
While the results showed complicated circumstances that:
1. Different types of proteins in crude enzymes may carry different amounts of disulfide bonds, so the enzymes cannot be compared with each other.
2. Whether keratinase has been reported to open disulfide bonds, or whether disulfide bonds are well-known enzymatic targets was still unclarified.
3. If time is too long, even if the disulfide bond is broken up, they may spontaneously oxidize and become disulfide bonds again. Therefore, this experimental method is not reliable at this stage.
It was supposed to confirm that the hair is degradable by the keratinase via a more straightforward qualitative method.
Qualitative
However, it is difficult to explain the actual effect of quantitative experiments for the purpose of hair removal, so qualitative experiments were added later. After the quantitative experiment, it can be concluded that two of the four keratinase enzymes have better effects. Based on this, the purpose of setting up the qualitative experiment is to visually show the effect of keratinase on hair degradation relative to chemical reagents.
Depilation and hair degradation：
① Porcine skin with hair
② Human hair
Among the two keratinase (KU3 and Q7), KU3 have shown comparably significant degradative function. Also the mixture of two enzymes shows a more significant degradation effect, presented in the Proof of Concept section.
REFERENCES
Suh, Hyung Joo, and Hyo Ku Lee. "Characterization of a keratinolytic serine protease from Bacillus subtilis KS-1." Journal of Protein Chemistry 20.2 (2001): 165-169.Ciurko, Dominika P., et al. "Enzymatic bioconversion of feather waste with keratinases of Bacillus cereus PCM 2849." Polish Journal of Chemical Technology 21.3 (2019).
Riffel, Alessandro, et al. "Purification and characterization of a keratinolytic metalloprotease from Chryseobacterium sp. kr6." Journal of biotechnology 128.3 (2007): 693-703.
Liu, Qingyang, et al. "Purification and characterization of four key enzymes from a feather-degrading Bacillus subtilis from the gut of tarantula Chilobrachys guangxiensis."
International Biodeterioration & Biodegradation 96 (2014): 26-32.
Bernal C, Diaz I, Coello N. Response surface methodology for the optimization of keratinase production in culture medium containing feathers produced by Kocuria rosea. Can J Microbiol. 2006 May;52(5):445-50. doi: 10.1139/w05-139. PMID: 16699569.
Radha, S., and P. Gunasekaran. "Cloning and expression of keratinase gene in Bacillus megaterium and optimization of fermentation conditions for the production of keratinase by recombinant strain." Journal of applied microbiology 103.4 (2007): 1301-1310.
Nnolim, Nonso E., et al. "Biochemical and molecular characterization of a thermostable alkaline metallo-keratinase from Bacillus sp. Nnolim-K1." Microorganisms 8.9 (2020): 1304.
Fakhfakh-Zouari, Nahed, et al. "A novel serine metallokeratinase from a newly isolated Bacillus pumilus A1 grown on chicken feather meal: biochemical and molecular characterization." Applied biochemistry and biotechnology 162.2 (2010): 329-344.
Fellahi, Soltana, et al. "Identification of two new keratinolytic proteases from a Bacillus pumilus strain using protein analysis and gene sequencing." AMB Express 6.1 (2016): 1-8.
Jaouadi, Nadia Zaraî, et al. "A novel keratinase from Bacillus tequilensis strain Q7 with promising potential for the leather bating process." International journal of biological macromolecules 79 (2015): 952-964.
Hu, Hong, et al. "Codon optimization significantly improves the expression level of a keratinase gene in Pichia pastoris." PLoS One 8.3 (2013): e58393.
