Team:SZ SHD/Contribution

Contribution

Loading...
Contact

Contribution


In this project, basic parts of previous projects were characterized.

Characterization of previous iGEM parts


T7 promoter (BBa_I719005)

Keratinases kerAvDZ50 (BBa_K3895007), kerBteQ7 (BBa_K3895008), kerBlMKU3 (BBa_K3895009), and kerBlER-15 (BBa_K3895010) were expressed by T7 promoter. The sequences were constructed into PET 28a(+) plasmids and transformed to E.coli BL21 (DE3).


PCR was conducted first for verification of the correct plasmids. Then the amplified DNAs were sequenced (forward primer: TCGATCCCGCGAAATTAATACG; reverse primer: AGGGGTTATGCTAGTTATTGCTCA) and compared with the designed DNA sequences for further verification.


Name of keratinase IPTG concentration/mM Temperature/°C Time/h
KerBteQ7 5 16 12
KerAVDZ50 0.67139 16 12
KerBIER15 0.4196 37 16
KerBIMKU3 0.4 37 4




Improvement of Existing Parts


1. Optimized keratinase KerA (BBa_K3895016)

Introduction
Click here to download the information about our dataset

The composite part BBa_K1717171 is an optimized version of KERA that can be constructed into pSB1C3 plasmid with the highest protein expression in E.coli BL21(DE3). The KERA is a basic part comprised from a synthesized KERA protein coding sequence. The gene can be expressed in cells by looking for clear areas of cell growth on AGAR plates of skimmed milk, and by observing keratin-containing substrates (feathers, hair, chemosynthetic keratin, etc.) growing with cells.


Plasmid Construction
Experiment details

• Throughput: 2500
• Organism: E. coli
• Strain type: BL21(DE3)
• Temperature: 37°C
• Media: 250 ml LB
• Period of time: 16 hours
• Plasmid backbone: pSB1C3
A. Vec platform was used to test the expression of KERA in more than 2000 random expression vectors. Different regulatory elements used in the vector can result in nearly 10 orders of magnitude difference in KERA expression.


2. Insecticidal protein (BBa_K3895012)

Bt toxins refer to the toxic proteins produced by insect pathogenic bacteria Bacillus thuringiensis[1]. This part was adjusted from SZ-SHD 2020's bt toxin Cry7Ca1 (BBa_K3686010) for tobacco wheat instant expression, where Cry7Ca1 is a differentiate of Bt toxins with a molecular mass of 129kDa, recently isolated from Bt strain BHT-13. Cry7Ca1 is connected with GFP (BBa_E0040),and constructed into pCAMBIA1301 vector.


Protocol

1. Transfection of pCAMBIA-Cry7Ca1-eGFP vector through Carbon dots nanocomposite (CDP) to Nicotiana benthamiana

Coupling CDP with plant expressing vector Mix the following ingredients:

Ingredients Volumn
MES buffer(50X) 10ul
CDP(50X) 10ul
DNA(237ng/ul >10ng/ul final con) 22ul
10% glycerol 25ul
ddH2O 433ul
total 500ul

Gently mix and incubate at 37℃ for 30min.
2. Brush the mixture gently on the leaf of Nicotiana benthamiana(leaf length>10cm,Growing well) ,mark the area of brushing
3. Put the plant back in the light incubator(28℃,12h light 12h dark), repeat the process for four days at 3:00pm each day(2/4)


Results

Fluorescence microscope to observe the GFP in leave.