Line 455: | Line 455: | ||
<div class="table-responsive"> | <div class="table-responsive"> | ||
<p>Formulae for terminator efficiency<a style="color: #8d1063;" href="#ref5">[5]</a></p> | <p>Formulae for terminator efficiency<a style="color: #8d1063;" href="#ref5">[5]</a></p> | ||
+ | |||
+ | |||
+ | |||
$TE_{Device}=\frac{mCherry_{0}}{sfGFP_{0}}$ | $TE_{Device}=\frac{mCherry_{0}}{sfGFP_{0}}$ | ||
<br> | <br> | ||
where, | where, | ||
− | |||
<br> | <br> | ||
$mCherry_{0}\rightarrow$ mCherry produced by device without terminator<br><br> | $mCherry_{0}\rightarrow$ mCherry produced by device without terminator<br><br> |
Revision as of 09:04, 15 October 2021
<!DOCTYPE html>
New Parts from literature:
Promoters:
In order to achieve robustness in the system, it is necessary to have a library of promoters with a wide range of transcription rates. One such library of synthetic promoters from Liu et al. (2018) consisted of 214 synthetic promoters with consensus sequence as shown below [1]:
![Trulli](./assets/SP Backbone.png)
Fig. 1 SP Backbone
All these promoters are constitutive hence can be used for general protein production. From this library we used SP126, SP146 and SP200 having relative activity with respect to P43 as follows:
Promotor |
Sequence 5‘ 3‘ |
Relative activity wrt P43 - GFP (%) |
Standard deviation |
---|---|---|---|
AAAAATTATAAAAATGTGTTGACAAAGGGGGTCCTGTATGTTATAATAGCTT |
29.07 |
0.23 |
|
AAAAATAACAAAAACGTGTTGACAATAAAGATTAACCGTGATATAATTAAAT |
40.39 |
0.69 |
|
AAAAATTAGAAAAATGTGTTGACACTCGGACGAAACAATGGTATAATGGCAA |
76.82 |
0.9 |
P22 Operator Library:
P22 repressor (BBa_K3889020) binds to this sequence as a dimer. This inhibits the enzymes from transcripting the genes on whose promoter this operator site is fused with. Hence this could be used with any promoter in order to form a repressible system. Different binding affinities of a repressor provides a variable system that can be used for different expression levels of the target thereby enabling its in a variety of systems.Optimization and tweaking of a system can be done by varying the operator sites as well.
Part Name |
Sequence |
Rel KD |
KD (in M) |
---|---|---|---|
ATTTAAGATATCTTAAAT |
1 |
1.6 × 10−8 |
|
AATTAAGATATCTTAATT |
1.8 |
2.88 × 10-8 |
|
ATTTAAGAATTCTTAAAT |
2 |
3.2 × 10−8 |
|
AGTTAAGATATCTTAACT |
2.6 |
4.16 × 10−8 |
|
ATTAAAGATATCTTTAAT |
3.8 |
6.08 × 10−8 |
|
ACTTAAGATATCTTAAGT |
4.3 |
6.88 × 10−8 |
|
ATTCAAGATATCTTGAAT |
5 |
8.0 × 10−8 |
|
ATTGAAGATATCTTCAAT |
7.6 |
1.216 × 10−7 |
|
ATTTAAGAGCTCTTAAAT |
10 |
1.6 × 10−7 |
|
ATTTAAGACGTCTTAAAT |
10 |
1.6 × 10−7 |
|
ATTTACGATATCGTAAAT |
30 |
4.8 × 10−7 |
|
ATTTAAAATATTTTAAAT |
55 |
8.8 × 10−7 |
![Trulli](./assets/p22_binding_site.png)
Coding sequences:
SRTF1 or steroid responsive transcription factor 1 can negatively regulate any promoter activity with which it is fused with. SRTF1 binds to its binding site(BBa_K3889030) as done in BBa_K3889150. Presence of progesterone causes unbinding of SRTF thereby releasing it from the DNA, inducing the target gene.Thus,progesterone acts as an inducer and can be used in a progesterone inducible system by other teams as well.[4]
Device:
Terminator checking device (BBa_K3889140): In order to check terminator efficiency a simple reference circuit was used similar to what used by Gale et al. (2021)[5] as shown below:
![Trulli](./assets/Termcheckdevice.jpg)
Now spacer can be replaced with any terminator in order to see the expression of sfGFP and mCherry.
![Trulli](./assets/Term to be checked.jpg)
Formulae for terminator efficiency[5]
$TE_{Device}=\frac{mCherry_{0}}{sfGFP_{0}}$where,
$mCherry_{0}\rightarrow$ mCherry produced by device without terminator
$sfGFP_{0}\rightarrow$ sfGFP produced by device without terminator
Using the device without any changes, $TE_{Device}$ can be calculated which gives the expression of
$mCherry$ in absence of a terminator.
$TE=100-\left[\left(\frac{mCherry}{sfGPF}\right)\times\left(\frac{1}{TE_{Device}}\right)\times100\right]$ (2)
where,
$mCherry$ $\rightarrow$ mCherry produced by device with the terminator that needs to checked
$sfGFP$ $\rightarrow$ sfGFP produced by device with the terminator that needs to checked
REFERENCES
[1] Liu, D., Mao, Z., Guo, J., Wei, L., Ma, H., Tang, Y., Chen, T., Wang, Z., & Zhao, X. (2018). Construction, Model-Based Analysis, and Characterization of a Promoter Library for Fine-Tuned Gene Expression in Bacillus subtilis. ACS Synthetic Biology, 7(7), 1785–1797. https://doi.org/10.1021/acssynbio.8b00115
[2] Yang, S., Du, G., Chen, J., & Kang, Z. (2017). Characterization and application of endogenous phase-dependent promoters in Bacillus subtilis. Applied Microbiology and Biotechnology, 101(10), 4151–4161. https://doi.org/10.1007/s00253-017-8142-7
[3] Watkins, D., Hsiao, C., Woods, K. K., Koudelka, G. B., & Williams, L. D. (2008). P22 c2 Repressor−Operator Complex: Mechanisms of Direct and Indirect Readout. Biochemistry, 47(8), 2325–2338. https://doi.org/10.1021/bi701826f
[4] Baer, R. Cooper (2020). Discovery, characterization, and ligand specificity engineering of a novel bacterial transcription factor inducible by progesterone Boston University School of Medicine, 801 Massachusetts Avenue Suite 400 Boston, MA 02118 Retrieved from : https://hdl.handle.net/2144/41109
[5] Gale, G. A. R., Wang, B., & McCormick, A. J. (2021). Evaluation and Comparison of the Efficiency of Transcription Terminators in Different Cyanobacterial Species. Frontiers in Microbiology, 11. https://doi.org/10.3389/fmicb.2020.624011
Gene Gala
We held a Mini-Summer school in collaboration with the iGEM 2021 team of IISER Kolkata. It was a 5 day Mini-Summer School for Girl students studying in 12th Standards of the schools under the Directorate of Education, GNCT Delhi. As part of the summer school, the two teams together prepared a 5 day lesson plan, 2 quiz sessions and a day-to -day handbook made for reference for the students. We would like to present these resources as a contribution to iGEM.
Future iGEM teams can use them directly for conducting similar programmes in their regions/countries to the relevant audiences giving proper attributions to both the contributing teams. These resources will be extremely useful for teams who are preparing for similar education events. Conducting classes for 5 day enriched with activities and quiz sessions can be a daunting task for teams. The lesson plan provided here was able to keep the students engaged throughout the 5 days and it was easy for the team members to present as well. These content handbooks, lesson plans and quizzes will come in handy for future iGEM teams to prepare for such an event and take their public engagement to the next level.
The content is relevant for introducing high school seniors to Synthetic Biology, while giving them a holistic and application based view of the biology courses taught at the high school level.
Drive link to the handbook, quizzes and lesson plan -
Zip File Name : Mini Summer school Resources -https://drive.google.com/folderview?id=1LkMO9n0KYhkKXA8lggWYrLmLnC2MjK4c
Note : It will be helpful if 2 people present the content, which will stop the lesson from becoming monotonous and keep students engaged.
![](./assets/OviCloak.webp)
![](./assets/iGEM Transparent Logo.png)
Our Sponsors
![](./assets/iisertlogo.webp)
![](./assets/GenScript.webp)
![](./assets/IDT.webp)
![](./assets/NEB.webp)
![](./assets/Geneious.webp)
![](./assets/Twist.webp)
![](./assets/Benchling.webp)
![](./assets/InVideo.webp)