Ahmadzidan (Talk | contribs) |
Ahmadzidan (Talk | contribs) |
||
(16 intermediate revisions by 2 users not shown) | |||
Line 14: | Line 14: | ||
<body data-bs-offset="360" data-bs-spy="scroll" data-bs-target="#sidebar"> | <body data-bs-offset="360" data-bs-spy="scroll" data-bs-target="#sidebar"> | ||
− | <nav class="navbar navbar-expand-lg navbar-light shadow sticky-top menu"> | + | <nav class="navbar navbar-expand-lg navbar-light shadow sticky-top menu" id="navbar"> |
<div class="container"> | <div class="container"> | ||
<a class="navbar-brand" href="#"> | <a class="navbar-brand" href="#"> | ||
− | <img height="50px" src="https://static.igem.org/mediawiki/2021/ | + | <img height="50px" src="https://static.igem.org/mediawiki/2021/f/f2/T--UGM_Indonesia--img--project-logo.png"/> |
</a> | </a> | ||
<button aria-controls="navbarNav" aria-expanded="false" aria-label="Toggle navigation" class="navbar-toggler" data-bs-target="#navbarNav" data-bs-toggle="collapse" type="button"> | <button aria-controls="navbarNav" aria-expanded="false" aria-label="Toggle navigation" class="navbar-toggler" data-bs-target="#navbarNav" data-bs-toggle="collapse" type="button"> | ||
Line 37: | Line 37: | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Engineering">Engineering</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Engineering">Engineering</a></li> | ||
− | |||
− | |||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Safety">Safety</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Safety">Safety</a></li> | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Contribution">Contribution</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Contribution">Contribution</a></li> | ||
− | |||
− | |||
</ul> | </ul> | ||
Line 58: | Line 54: | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Results">Results</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Results">Results</a></li> | ||
+ | |||
+ | <li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Notebook">Notebook</a></li> | ||
</ul> | </ul> | ||
Line 69: | Line 67: | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Bioreactor">Bioreactor</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Bioreactor">Bioreactor</a></li> | ||
− | |||
− | |||
</ul> | </ul> | ||
Line 80: | Line 76: | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Human_Practices">Human Practices</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Human_Practices">Human Practices</a></li> | ||
+ | |||
+ | <li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/IHP">Integrated Human Practices</a></li> | ||
+ | |||
+ | <li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Implementation">Proposed Implementation</a></li> | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Communication">Education and Communication</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Communication">Education and Communication</a></li> | ||
+ | |||
+ | <li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Education">Education and Public Engagement</a></li> | ||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Entrepreneurship">Entrepreneurship</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Entrepreneurship">Entrepreneurship</a></li> | ||
+ | |||
+ | <li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Sustainable">Sustainable Development Impact</a></li> | ||
</ul> | </ul> | ||
Line 106: | Line 110: | ||
<a aria-expanded="false" class="nav-link mx-2" href="#" id="projectNavbarDropdown" role="button">Medals</a> | <a aria-expanded="false" class="nav-link mx-2" href="#" id="projectNavbarDropdown" role="button">Medals</a> | ||
<ul aria-labelledby="projectNavbarDropdown" class="dropdown-menu"> | <ul aria-labelledby="projectNavbarDropdown" class="dropdown-menu"> | ||
− | |||
− | |||
<li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Medals">Medals</a></li> | <li><a class="dropdown-item" href="https://2021.igem.org/Team:UGM_Indonesia/Medals">Medals</a></li> | ||
Line 121: | Line 123: | ||
<main> | <main> | ||
<style> | <style> | ||
− | .hero { | + | #hero.hero .hero-image { |
background-image: url("https://static.igem.org/mediawiki/2021/a/a8/T--UGM_Indonesia--img--hero-contribution.jpg"); | background-image: url("https://static.igem.org/mediawiki/2021/a/a8/T--UGM_Indonesia--img--hero-contribution.jpg"); | ||
} | } | ||
Line 128: | Line 130: | ||
<section class="hero" id="hero"> | <section class="hero" id="hero"> | ||
<div class="container-fluid"> | <div class="container-fluid"> | ||
− | <div class="row d-flex flex-column justify-content-center align-items-center"> | + | <div class="row hero-image"> |
+ | </div> | ||
+ | <div class="row hero-content d-flex flex-column justify-content-center align-items-center"> | ||
<h1 class="hero-decorative decorative-right"> | <h1 class="hero-decorative decorative-right"> | ||
Contribution | Contribution | ||
Line 142: | Line 146: | ||
</div> | </div> | ||
</section> | </section> | ||
− | <section class="main-content | + | <section class="main-content" id="main-content"> |
<div class="container"> | <div class="container"> | ||
<div class="row"> | <div class="row"> | ||
<nav class="navbar navbar-light flex-column align-items-stretch col-3 p-1 d-none d-lg-block sticky-sidebar" id="sidebar"> | <nav class="navbar navbar-light flex-column align-items-stretch col-3 p-1 d-none d-lg-block sticky-sidebar" id="sidebar"> | ||
<nav class="nav nav-pills flex-column sticky-top sticky-offset"> | <nav class="nav nav-pills flex-column sticky-top sticky-offset"> | ||
− | + | <ul> | |
− | < | + | |
− | + | <li> | |
− | + | <a class="nav-link" href="#experimental">Experimental Data</a> | |
− | + | ||
+ | </li> | ||
+ | |||
+ | </ul> | ||
</nav> | </nav> | ||
</nav> | </nav> | ||
− | + | <div class="col-12 col-lg-9"> | |
− | <div class="col-12 col-lg-9"> | + | <section id="experimental"><h4 class="display-4 text-primary">Experimental Data</h4><p>We conducted experiments toward the construction of BBa_K1602055 encoding the AraC-pBAD promoter into the pSB1C3 vector in the <i>E. coli</i> expression system. In this study, the level of its expression was compared within two strains of <i>E. coli</i>, \(BL21(DE3)\) and \(DH5α\), to investigate the expression profile. Several putative transformant colonies selected on LB agar medium supplemented with Chloramphenicol antibiotic and verified by colony PCR using VF2 VR primers (<b>Table 1</b>).</p><p> </p><table class="table table-bordered text-center"><caption class="text-center"><b>Table 1.</b> Sequence of VF2 and VR Primers.</caption><thead><tr><th scope="col">Primer</th><th scope="col">Sequence</th></tr></thead><tbody><tr> <td>VF2</td><td>TGCCACCTGACGTCTAAGAA</td></tr><tr> <td>VR</td><td>GCTCACTCAAAGGCGGTAAT</td></tr></tbody></table><p> Overnight cultures from positive clones were used as inoculum (1% v/v) to make the working cultures. Additionally, <i>E. coli</i> strains, \(BL21(DE3)\) and \(DH5α\), without carrying targeted genes were cultivated as the control. The working cultures (LB broth supplemented with chloramphenicol) were incubated at 37oC and 200 rpm agitation. When the OD reached 0.1, 2mM L-arabinose was added to the medium as the inducer. For the control, we use a non-transformed culture of <i>E. coli</i> \(BL21(DE3)\) and \(DH5α\). The cell growth is measured using spectrophotometer OD 600 and the fluorescence intensity is measured using fluorometer with excitation and emission at 504 nm and 515 nm wavelength respectively.<a href="#reference-1"><sup>1</sup></a></p><p> All the <i>E. coli</i> transformant strain \(BL21(DE3)\) and \(DH5α\) showed lower exponential growth compared to control (<b>Figure 1</b>). Thus, it indicated that the cells were in fact growing slowly. This result suggested a higher metabolic burden of transformed strain. The foreign genetic part (BBa_K1602055) expression demands more cellular resources and energy, which competes with native host metabolism.<a href="#reference-2"><sup>2</sup></a>Hence, the host cells may suffer from delayed growth at the beginning. The lag phase of <i>E. coli</i> \(BL21(DE3)\) clones from both transformant and control showed a shorter lag phase compared to the \(DH5α\). It indicated that \(BL21(DE3)\) has a better metabolic profile and less sensitive to metabolic stress.<a href="#reference-3"><sup>3</sup></a></p><figure class="text-center"><img alt="Figure 1. Comparison of the growth curve between (a) the transformant (BL18P) and control (BLCTRL) in E. coli strain BL21(DE3), and (b) transformant (DH18P) and control (DHCTRL) in E. coli strain DH5α. The measurement was carried out by spectrophotometry at 600 nm." class="figure-img img-fluid rounded" src="https://static.igem.org/mediawiki/2021/2/24/T--UGM_Indonesia--img--contribution-figure-1.jpg"/><figcaption class="figure-caption"><b>Figure 1.</b> Comparison of the growth curve between (a) the transformant (BL18P) and control (BLCTRL) in E. coli strain BL21(DE3), and (b) transformant (DH18P) and control (DHCTRL) in E. coli strain DH5α. The measurement was carried out by spectrophotometry at 600 nm.</figcaption></figure><p> The fluorescence protein was expressed in the transformant cells from both <i>E. coli</i> strains after the induction of L-arabinose. Both \(BL21(DE3)\) and \(DH5α\) clones were induced after approximately three hours of cultivation. As we expected, the fluorescence excitation depicted that expression of GFP was significantly higher in \(BL21(DE3)\) clones compared to \(DH5α\) clones. It revealed that the DH5α strain is not specialized for heterologous protein expression (<b>Figure 2</b>).</p><figure class="text-center"><img alt="Figure 2. Result of fluorescence measurement: (a) BL21(DE3) transformed and the control, (b) DH5α transformed and the control." class="figure-img img-fluid rounded" src="https://static.igem.org/mediawiki/2021/0/0a/T--UGM_Indonesia--img--contribution-figure-2.jpg"/><figcaption class="figure-caption"><b>Figure 2.</b> Result of fluorescence measurement: (a) BL21(DE3) transformed and the control, (b) DH5α transformed and the control.</figcaption></figure><p> After 6 hours of culture, the remaining cells were harvested by centrifugation at 6,800 rpm for 3 minutes and observed under UV transillumination. The fluorescence of the \(DH5α\) clones was very low to be seen, the GFP expression in \(BL21(DE3)\) showed remarkably high. It can be noticed by the greenish luminescence of the cell pellet (<b>Figure 3</b>).</p><figure class="text-center"><img alt="Figure 3. GFP luminescence under the UV light of each cell pellet for BL21(DE3) clone (left) and DH5α clone (right) after centrifugation" class="figure-img img-fluid rounded" src="https://static.igem.org/mediawiki/2021/f/f0/T--UGM_Indonesia--img--contribution-figure-3.jpg" style="max-width:25%; width:25%;"/><figcaption class="figure-caption"><b>Figure 3.</b> GFP luminescence under the UV light of each cell pellet for BL21(DE3) clone (left) and DH5α clone (right) after centrifugation.</figcaption></figure></section> |
− | + | ||
+ | <section class="content-references" id="references"> | ||
<h4 class="display-4 text-primary mb-4"> | <h4 class="display-4 text-primary mb-4"> | ||
− | + | References | |
</h4> | </h4> | ||
− | < | + | <ol> |
− | + | ||
− | + | <li id="reference-1"> | |
− | + | Anonymous, 2020, <i>Part:BBa_E0040</i> | |
− | + | ||
− | + | [Online] | |
− | + | ||
− | + | ||
− | + | <a href="http://parts.igem.org/Part:BBa_E0040" target="_blank">http://parts.igem.org/Part:BBa_E0040</a> | |
− | + | ||
− | + | ||
− | </section> | + | [accessed on October 20, 2021 at 16.36 WIT] |
− | </div> | + | |
+ | </li> | ||
+ | |||
+ | <li id="reference-2"> | ||
+ | Shariarti, F.S., Keramati, M., Valzadeh, V., Cohan, R.A., Norouzian, D., 2021, Comparison of <i>E. coli</i> based self‑inducible expression systems containing different human heat shock proteins,<i>Scientific Report</i>, vol. 11, no. 4576. | ||
+ | |||
+ | |||
+ | |||
+ | </li> | ||
+ | |||
+ | <li id="reference-3"> | ||
+ | Phue, J.N., Lee, S.J., Trinch, L., Shiloach, J., 2008, Modified <i>Escherichia coli</i> B (BL21), a Superior Producer of Plasmid DNA Compared with <i>Escherichia coli</i> K (DH5-alpha), <i>Biotechnology and Bioengineering</i>, vol. 101, no. 4, pp. 831 – 836. | ||
+ | |||
+ | |||
+ | |||
+ | </li> | ||
+ | |||
+ | <ol> | ||
+ | </ol></ol></section> | ||
+ | |||
+ | </div> | ||
</div> | </div> | ||
</div> | </div> | ||
Line 178: | Line 206: | ||
</main> | </main> | ||
− | <footer class="container"> | + | <footer class="container-fluid" id="footer"> |
− | <div class="row border-top | + | <div class="container"> |
− | + | <div class="row py-5"> | |
− | <p> | + | <div class="col-12"> |
− | + | <div class="d-flex align-content-between align-items-center justify-content-center flex-wrap sponsors p-4"> | |
− | </p> | + | |
+ | <img alt="Universitas Gadjah Mada" class="mx-4 my-4" src="https://static.igem.org/mediawiki/2021/1/13/T--UGM_Indonesia--img--sponsor-ugm.png" style="max-height: 90px"/> | ||
+ | |||
+ | <img alt="Universitas Gadjah Mada" class="mx-4 my-4" src="https://static.igem.org/mediawiki/2021/0/03/T--UGM_Indonesia--img--sponsor-genscript.png" style="max-height: 75px"/> | ||
+ | |||
+ | <img alt="Universitas Gadjah Mada" class="mx-4 my-4" src="https://static.igem.org/mediawiki/2021/1/10/T--UGM_Indonesia--img--sponsor-rentokill.png" style="max-height: 50px"/> | ||
+ | |||
+ | <img alt="Universitas Gadjah Mada" class="mx-4 my-4" src="https://static.igem.org/mediawiki/2021/4/44/T--UGM_Indonesia--img--sponsor-geneious.png" style="max-height: 40px"/> | ||
+ | |||
+ | <img alt="Universitas Gadjah Mada" class="mx-4 my-4" src="https://static.igem.org/mediawiki/2021/2/28/T--UGM_Indonesia--img--sponsor-its.png" style="max-height: 50px"/> | ||
+ | |||
+ | <img alt="Universitas Gadjah Mada" class="mx-4 my-4" src="https://static.igem.org/mediawiki/2021/d/df/T--UGM_Indonesia--img--sponsor-twistbio.png" style="max-height: 45px"/> | ||
+ | |||
+ | <img alt="Universitas Gadjah Mada" class="mx-4 my-4" src="https://static.igem.org/mediawiki/2021/7/7a/T--UGM_Indonesia--img--sponsor-idt.png" style="max-height: 35px"/> | ||
+ | |||
+ | <img alt="Universitas Gadjah Mada" class="mx-4 my-4" src="https://static.igem.org/mediawiki/2021/6/67/T--UGM_Indonesia--img--sponsor-biotek.png" style="max-height: 30px"/> | ||
+ | |||
+ | <img alt="Universitas Gadjah Mada" class="mx-4 my-4" src="https://static.igem.org/mediawiki/2021/6/65/T--UGM_Indonesia--img--sponsor-biology.png" style="max-height: 40px"/> | ||
+ | |||
+ | <img alt="Universitas Gadjah Mada" class="mx-4 my-4" src="https://static.igem.org/mediawiki/2021/3/3c/T--UGM_Indonesia--img--sponsor-agriculture.png" style="max-height: 40px"/> | ||
+ | |||
+ | <img alt="Universitas Gadjah Mada" class="mx-4 my-4" src="https://static.igem.org/mediawiki/2021/1/1f/T--UGM_Indonesia--img--sponsor-pharmacy.png" style="max-height: 40px"/> | ||
+ | |||
+ | <img alt="Universitas Gadjah Mada" class="mx-4 my-4" src="https://static.igem.org/mediawiki/2021/2/2c/T--UGM_Indonesia--img--sponsor-engineering.png" style="max-height: 40px"/> | ||
+ | |||
+ | <img alt="Universitas Gadjah Mada" class="mx-4 my-4" src="https://static.igem.org/mediawiki/2021/f/f3/T--UGM_Indonesia--img--sponsor-kkmk.png" style="max-height: 40px"/> | ||
+ | |||
+ | <img alt="Universitas Gadjah Mada" class="mx-4 my-4" src="https://static.igem.org/mediawiki/2021/9/9e/T--UGM_Indonesia--img--sponsor-feb.png" style="max-height: 40px"/> | ||
+ | |||
+ | </div> | ||
+ | </div> | ||
+ | </div> | ||
+ | <div class="row border-top pt-5 pb-2 d-flex align-items-center" id="footer-contact"> | ||
+ | <div class="col-12 col-lg-1 my-4 d-flex flex-row flex-lg-column justify-content-center footer-logo"> | ||
+ | <img alt="Universitas Gadjah Mada Logo" class="img-fluid my-2 mx-4 mx-lg-0" src="https://static.igem.org/mediawiki/2021/f/f1/T--UGM_Indonesia--img--logo-ugm-white.png"/> | ||
+ | <img alt="iGEM UGM 2021 Logo" class="img-fluid my-2 mx-4 mx-lg-0" src="https://static.igem.org/mediawiki/2021/0/0b/T--UGM_Indonesia--img--logo-igem-ugm-white.png"/> | ||
+ | </div> | ||
+ | <div class="col-12 col-lg-6 d-flex flex-column align-items-center align-items-lg-start my-4 ps-2 ps-lg-4 footer-address"> | ||
+ | <h5 class="text-center text-lg-start"> | ||
+ | iGEM UGM | ||
+ | </h5> | ||
+ | <p class="text-center text-lg-start"> | ||
+ | Bulaksumur F11, Caturtunggal, Kecamatan Depok, Kabupaten Sleman, Daerah Istimewa Yogyakarta, Indonesia 55281 | ||
+ | </p> | ||
+ | <a class="mt-2" href="mailto:igemugm@gmail.com"> | ||
+ | <p class="text-center text-lg-start"> | ||
+ | igemugm@gmail.com | ||
+ | </p> | ||
+ | </a> | ||
+ | </div> | ||
+ | <div class="col-12 col-lg-5 my-4 d-flex flex-column align-items-center footer-social-media"> | ||
+ | <h4> | ||
+ | Get in Touch! | ||
+ | </h4> | ||
+ | <ul class="list-unstyled d-flex flex-row justify-content-center align-items-center flex-wrap"> | ||
+ | <li> | ||
+ | <a href="https://www.instagram.com/igem_ugm/" rel="noopener noreferrer" target="_blank"> | ||
+ | <i class="fab fa-instagram"></i> | ||
+ | </a> | ||
+ | </li> | ||
+ | <li> | ||
+ | <a href="https://twitter.com/igem_ugm" rel="noopener noreferrer" target="_blank"> | ||
+ | <i class="fab fa-twitter"></i> | ||
+ | </a> | ||
+ | </li> | ||
+ | <li> | ||
+ | <a href="https://www.youtube.com/channel/UCmauJ9hUdzTSubf8BXBZrFg" rel="noopener noreferrer" target="_blank"> | ||
+ | <i class="fab fa-youtube"></i> | ||
+ | </a> | ||
+ | </li> | ||
+ | <li> | ||
+ | <a href="https://www.linkedin.com/company/igemugm" rel="noopener noreferrer" target="_blank"> | ||
+ | <i class="fab fa-linkedin"></i> | ||
+ | </a> | ||
+ | </li> | ||
+ | |||
+ | </ul> | ||
+ | </div> | ||
+ | </div> | ||
+ | <div class="row mt-2 d-flex flex-row justify-content-center" id="footer-license"> | ||
+ | <p class="text-center"> | ||
+ | All content on this wiki is available under the <a href="https://creativecommons.org/licenses/by/4.0/" rel="license" target="_blank">Creative Commons Attribution 4.0 license</a> (or any later version). | ||
+ | </p> | ||
</div> | </div> | ||
</div> | </div> | ||
<script src="https://2021.igem.org/Template:UGM_Indonesia/js/bootstrap-bundle-minJS?action=raw&ctype=text/javascript"></script> | <script src="https://2021.igem.org/Template:UGM_Indonesia/js/bootstrap-bundle-minJS?action=raw&ctype=text/javascript"></script> | ||
+ | <script async="" id="MathJax-script" src="https://2021.igem.org/Template:UGM_Indonesia/js/mathjax/tex-mml-chtmlJS?action=raw&ctype=text/javascript"></script> | ||
</footer> | </footer> | ||
Latest revision as of 04:36, 11 December 2021
<!DOCTYPE html>
Experimental Data
We conducted experiments toward the construction of BBa_K1602055 encoding the AraC-pBAD promoter into the pSB1C3 vector in the E. coli expression system. In this study, the level of its expression was compared within two strains of E. coli, \(BL21(DE3)\) and \(DH5α\), to investigate the expression profile. Several putative transformant colonies selected on LB agar medium supplemented with Chloramphenicol antibiotic and verified by colony PCR using VF2 VR primers (Table 1).
Primer | Sequence |
---|---|
VF2 | TGCCACCTGACGTCTAAGAA |
VR | GCTCACTCAAAGGCGGTAAT |
Overnight cultures from positive clones were used as inoculum (1% v/v) to make the working cultures. Additionally, E. coli strains, \(BL21(DE3)\) and \(DH5α\), without carrying targeted genes were cultivated as the control. The working cultures (LB broth supplemented with chloramphenicol) were incubated at 37oC and 200 rpm agitation. When the OD reached 0.1, 2mM L-arabinose was added to the medium as the inducer. For the control, we use a non-transformed culture of E. coli \(BL21(DE3)\) and \(DH5α\). The cell growth is measured using spectrophotometer OD 600 and the fluorescence intensity is measured using fluorometer with excitation and emission at 504 nm and 515 nm wavelength respectively.1
All the E. coli transformant strain \(BL21(DE3)\) and \(DH5α\) showed lower exponential growth compared to control (Figure 1). Thus, it indicated that the cells were in fact growing slowly. This result suggested a higher metabolic burden of transformed strain. The foreign genetic part (BBa_K1602055) expression demands more cellular resources and energy, which competes with native host metabolism.2Hence, the host cells may suffer from delayed growth at the beginning. The lag phase of E. coli \(BL21(DE3)\) clones from both transformant and control showed a shorter lag phase compared to the \(DH5α\). It indicated that \(BL21(DE3)\) has a better metabolic profile and less sensitive to metabolic stress.3
The fluorescence protein was expressed in the transformant cells from both E. coli strains after the induction of L-arabinose. Both \(BL21(DE3)\) and \(DH5α\) clones were induced after approximately three hours of cultivation. As we expected, the fluorescence excitation depicted that expression of GFP was significantly higher in \(BL21(DE3)\) clones compared to \(DH5α\) clones. It revealed that the DH5α strain is not specialized for heterologous protein expression (Figure 2).
After 6 hours of culture, the remaining cells were harvested by centrifugation at 6,800 rpm for 3 minutes and observed under UV transillumination. The fluorescence of the \(DH5α\) clones was very low to be seen, the GFP expression in \(BL21(DE3)\) showed remarkably high. It can be noticed by the greenish luminescence of the cell pellet (Figure 3).
References
- Anonymous, 2020, Part:BBa_E0040 [Online] http://parts.igem.org/Part:BBa_E0040 [accessed on October 20, 2021 at 16.36 WIT]
- Shariarti, F.S., Keramati, M., Valzadeh, V., Cohan, R.A., Norouzian, D., 2021, Comparison of E. coli based self‑inducible expression systems containing different human heat shock proteins,Scientific Report, vol. 11, no. 4576.
- Phue, J.N., Lee, S.J., Trinch, L., Shiloach, J., 2008, Modified Escherichia coli B (BL21), a Superior Producer of Plasmid DNA Compared with Escherichia coli K (DH5-alpha), Biotechnology and Bioengineering, vol. 101, no. 4, pp. 831 – 836.