Team:UGM Indonesia/Contribution
<!DOCTYPE html>
Experimental Data
We conducted experiments toward the construction of BBa_K1602055 encoding the AraC-pBAD promoter into the pSB1C3 vector in the E. coli expression system. In this study, the level of its expression was compared within two strains of E. coli, \(BL21(DE3)\) and \(DH5α\), to investigate the expression profile. Several putative transformant colonies selected on LB agar medium supplemented with Chloramphenicol antibiotic and verified by colony PCR using VF2 VR primers (Table 1).
| Primer | Sequence |
|---|---|
| VF2 | TGCCACCTGACGTCTAAGAA |
| VR | GCTCACTCAAAGGCGGTAAT |
Overnight cultures from positive clones were used as inoculum (1% v/v) to make the working cultures. Additionally, E. coli strains, \(BL21(DE3)\) and \(DH5α\), without carrying targeted genes were cultivated as the control. The working cultures (LB broth supplemented with chloramphenicol) were incubated at 37oC and 200 rpm agitation. When the OD reached 0.1, 2mM L-arabinose was added to the medium as the inducer. For the control, we use a non-transformed culture of E. coli \(BL21(DE3)\) and \(DH5α\). The cell growth is measured using spectrophotometer OD 600 and the fluorescence intensity is measured using fluorometer with excitation and emission at 504 nm and 515 nm wavelength respectively.1
All the E. coli transformant strain \(BL21(DE3)\) and \(DH5α\) showed lower exponential growth compared to control (Figure 1). Thus, it indicated that the cells were in fact growing slowly. This result suggested a higher metabolic burden of transformed strain. The foreign genetic part (BBa_K1602055) expression demands more cellular resources and energy, which competes with native host metabolism.2Hence, the host cells may suffer from delayed growth at the beginning. The lag phase of E. coli \(BL21(DE3)\) clones from both transformant and control showed a shorter lag phase compared to the \(DH5α\). It indicated that \(BL21(DE3)\) has a better metabolic profile and less sensitive to metabolic stress.3
The fluorescence protein was expressed in the transformant cells from both E. coli strains after the induction of L-arabinose. Both \(BL21(DE3)\) and \(DH5α\) clones were induced after approximately three hours of cultivation. As we expected, the fluorescence excitation depicted that expression of GFP was significantly higher in \(BL21(DE3)\) clones compared to \(DH5α\) clones. It revealed that the DH5α strain is not specialized for heterologous protein expression (Figure 2).
After 6 hours of culture, the remaining cells were harvested by centrifugation at 6,800 rpm for 3 minutes and observed under UV transillumination. The fluorescence of the \(DH5α\) clones was very low to be seen, the GFP expression in \(BL21(DE3)\) showed remarkably high. It can be noticed by the greenish luminescence of the cell pellet (Figure 3).
References
- Anonymous, 2020, Part:BBa_E0040 [Online] http://parts.igem.org/Part:BBa_E0040 [accessed on October 20, 2021 at 16.36 WIT]
- Shariarti, F.S., Keramati, M., Valzadeh, V., Cohan, R.A., Norouzian, D., 2021, Comparison of E. coli based self‑inducible expression systems containing different human heat shock proteins,Scientific Report, vol. 11, no. 4576.
- Phue, J.N., Lee, S.J., Trinch, L., Shiloach, J., 2008, Modified Escherichia coli B (BL21), a Superior Producer of Plasmid DNA Compared with Escherichia coli K (DH5-alpha), Biotechnology and Bioengineering, vol. 101, no. 4, pp. 831 – 836.