Team:UI Indonesia/Protocol

PROTOCOL

Polymerase Chain Reaction (PCR) ¹

Materials

1. PCR mix contains:
   • Q5® High-Fidelity 2X Master Mix
   • Forward Primer
   • Reverse Primer
   • Nuclease Free Water
   • DNA Template
2. 0.2 ml PCR Tube
3. T100TM Thermal Cycler

Methods

1. Make the PCR Mix inside a microtube:

   Component	100 µl RXN	Final Concentration
   10 µM Forward Primer	5 µl	0.5 µM
   10 µM Reverse Primer	5 µl	0.5 µM
   Q5®High-Fidelity 2X Master Mix	50 µl	1X
   DNA Template	10 µl	1 ng/µl
   Nuclease Free Water	to 30 µl	-

2. Aliquot the mix into 10 PCR tubes 0.2 ml
3. Put PCR tubes inside T100TM Thermal Cycler with these settings:

   Step	Temperature	Time
   Initial denaturation	98oC	30 sec
   Annealing (30 cycles)	98oC	10 sec
   	50-60oC	30 sec
   	72oC	30-60 sec
   Final Extension	71oC	2 min




 

DNA Electrophoresis ¹

Materials

1. Agarose 0.8 g
2. EcoDyeTM Nucleic Acid Staining Solution
3. Gel Loading Dye, Purple (6X)
4. Quick-Load® Purple 1kb Plus DNA Ladder
5. TAE Buffer 0.5X
6. Agarose Well Mold
7. MUPID-exU Horizontal Electrophoresis System
8. DNA Sample

Methods

1. Make the agarose 0.8 g:
   • Mix 0.8 g of agarose with 100ml TAE buffer 0.5X
   • Put the mix inside the microwave for 5 minutes
   • Put 2 µl EcoDye into the mixture
   • Wait till warm
   • Mold the agarose well and wait until it hardens
2. Fill MUPID-exU with TAE Buffer 0.5X
3. Put the agarose inside MUPID-exU Horizontal Electrophoresis System
4. Fill the first well with Quick-Load® Purple 1kb Plus DNA Ladder
5. Re-suspense 3µl of DNA sample with 1µl of Gel Loading Dye, Purple (6X)
6. Insert the resuspended DNA sample into the rest of the well
7. Set the voltage of MUPID-exU into 100V for 30 minutes
8. Read the result in Gel Doc® XR

Desalting and DNA Concentrating ¹

Materials

1. Buffer QX1
2. QIAEX II Gel Extraction Kit
3. PE Buffer
4. EB Water 0.3X
5. Sodium Acetate 3M
6. Centrifuge
7. Vortex Mixer
8. DNA Sample

Methods

1. Add 3 volumes of Buffer QX1 to 1 volume of sample
2. Add 10µl of Sodium Acetate 3M
3. Resuspend QIAEX II by vortexing
4. Add 10µl of QIAEX II for every 5µg of DNA and mix
5. Incubate at room temperature for 10 minutes and make sure QIAEX II in in suspension
6. Centrifuge 12.000rpm for 1 minute
7. Remove supernatant
8. Wash the pellet twice using 500µl of Buffer PE
9. Air dry pellet for 5 minutes
10. Elute DNA using 20µl EB Water 0.3X and resuspend pellet by vortexing
11. Incubate DNA at room temperature for fragments ≤4kb and 50C for fragments >4kb
12. Incubate for 5 minutes
13. Centrifuge at 12000 rpm for 1 minute
14. Carefully transfer the supernatant into a clean tube
15. Repeat step 10-14 and combine the elutes

Gibson Assembly ²

A. Digestion

Materials

• 1 µg Plasmid
• 5 µl 10X NEBuffer r3.1
• 1 µl (5 units) NcoI restriction enzyme
• Nuclease-free water

Equipment

• Thermocycler
• Ice container

Methods

1. Add 1 µg of DNA to be digested
2. Add 10X NEBuffer r3.1
3. Add 1 µl (5 units) of NcoI
4. Adjust with dH20 until a total volume of 50µl, mix well
5. Incubate the restriction digest at 37°C for 5-15 mins, and then 80°C for 20 min to heat kill the enzyme

B. Assembly

1. Mix fragments, Mastermix, and deionized water into an Eppendorf tube*
2. Incubate the tube in a thermocycler at 50°C for 15 minutes (2—3 fragments) or 60 minutes (4—6 fragments)
3. Incubate the tube in a thermocycler at 50°C for 15 minutes (2—3 fragments) or 60 minutes (4—6 fragments)
4. The newly assembled plasmid is ready to be transformed

*The amount of reagents are listed below

Sequences (5’-...-3’) (Total bp)	Primer (5’- ANNEAL -3’)
pCopA :: RBS :: SUMO-AMP :: TT (9508 bp)	Forward: ccggttatgcagaaaaaaacCCTTTTTATAGATGCGGG Reverse: tcggtggaagcttcccaaccAAATAATAAAAAAGCCGGATTAATAATC
pCopA :: TetR :: pTet :: cI :: pcI :: Ulp-1 (11,714 bp)	Forward: ccggttatgcagaaaaaaacCCTTTTTATAGATGCGGG   Reverse: tcggtggaagcttcccaaccAAATAATAAAAAAGCCGGATTAATAATC
pCopA :: TetR :: pTet :: pcI :: kill switch (12,640 bp)	Forward: ccggttatgcagaaaaaaacCCTTTTTATAGATGCGGGAGG      Reverse: tcggtggaagcttcccaaccGAGAGCGTTCACCGACAAAC
araC/pBAD-Proteinase K (11,328 bp)	Forward: ccggttatgcagaaaaaaacTCACACTGGCTCACCTTC Reverse: tcggtggaagcttcccaaccAAATAATAAAAAAGCCGGATTAATAATCTG
glnAp2-TetR-pTet-E7 (10,233 bp)	Forward ccggttatgcagaaaaaaacTAGATGCCTCCACACCGC   Reverse tcggtggaagcttcccaaccAAATAATAAAAAAGCCGGATTAATAATCTGGC

Bacteria (competent cells) preparation ³

A. Tetracycline-LB Agar Preparation

Materials

• 1 L sterile H₂O/Aquadest
• 10 g tryptone
• 10 g NaCl
• NaOH (to adjust)
• 12 g agar-agar
• 10 g tetracycline

Equipment

• Autoclave (15 psi, 20 min)
• Agar plate
• Sterile flask

Methods

1. Combine all the materials except tetracycline
2. Shake until dissolved
3. Adjust the pH until it reaches the pH of 7.0
4. Autoclave the materials for 20 minutes (121°C, 15 psi or 1.05 kg/cm²) on liquid cycle
5. Let cool until 60°C, then add in 10g of tetracycline
6. Put the mixture into a 60°C water bath until all the tetracycline dissolves
7. Pour the mixture into the sterilized agar plate
8. Inoculate the transformant into the agar plate accordingly

It is best to test the agar before using it for the selection by inoculate a sample of tetracycline-resistant and tetracycline-sensitive bacteria.
The expected results are shown in the table below.

Results	Antibiotic Resistance (TcR)	Fluorescent Characteristics
Successful Transformant with Correct Plasmid	+	-
Successful Transformant with Unligated Plasmid	+	+
Unsuccessful Transformant	-	-

Afterward, the result will be reaffirmed using Colony PCR. For the procedure, we will be using the same primers for all plasmids as shown in the table below. We used primer-BLAST provided by NCBI to design the primers.

Direction	Sequence (5’-..-3’)	Tm (oC)	Target	Amplicon Length (bp)
Forward	TTCACACTGGCTCACCTTCG	60.25	Upstream junction (TT - pM2s2TsR)	137
Reverse	CCGTCTTCCGGGTACATACG	59.97

B. Cell Harvesting

1. Take one single colony of bacteria (without plasmid) and inoculate into 20-25 mL of Luria-Bertani (LB) medium in a 50 mL conical centrifuge tube and shake in the incubator (37°) for 14-16 hours
2. Prepare the following ingredients afterwards:
   • LB medium, autoclave, put in refrigerator
   • 0.1 M CaCl₂, autoclave before use, put in 4°C freezer
   • 0.1 M MgCl₂, autoclave before use, put in 4°C freezer
   • SOC medium in room temperature
   • Chilled until freezing centrifuge rotor, micropipette tips, and microcentrifuge tubes
3. From each of the overnighted LB medium, take 100 μL of bacterial culture and place it into new 20 mL of LB medium in a 50 mL conical centrifugal tube and shake in the incubator (37°C) for 2 hours
4. Harvest the cells by centrifuge at 3500 rpm speed for 10 minutes at 4°C (Starting from this point, all steps and material must be in 4°C or below temperature
5. Decant the supernatant and resuspend the pellet with 4 mL (~⅕ of initial medium volume) of cold (4°C) autoclaved MgCl₂. Incubate the tube with resuspended pellet in an ice box for 15-20 minutes
6. Harvest the cells by centrifuge at 3500 rpm speed for 10 minutes at 4°C
7. Decant the supernatant and resuspend the pellet with 400 μL (~1/50 of initial medium volume) of cold (4°C) autoclaved CaCl₂. Incubate the tube with resuspended pellet in an ice box for 1 hour
8. Harvest the cells by centrifuge at 3500 rpm speed for 10 minutes at 4°C
Decant the supernatant and resuspend the pellet with 200 μL (~1/100 of initial medium volume) of cold (4°C) autoclaved CaCl₂
9. Aliquote 50 μL into the cold microfuge tube. Competent cells are ready for transformation
10. Store the competent cells in the microfuge tube with addition of a ¼ volume of the 75% autoclaved glycerol in the -80°C freezer if it is not used immediately

Bacterial Transformation (Electroporation) ³

Materials

• LB broth
• Tetracycline
• ddH₂O

Equipment

• Autoclave
• Test tubes
• Cell spreader
• Petri dishes
• Centrigue
• Electroporation cuvette
• Electroporation chamber

Methods

1. Prepare LB-agar without antibiotics and pour into petri dishes in preparation of the electrocompetence protocol, and LB-agar plates containing tetracycline, and store at 4°C
2. Deliver 100 μl of the overnight bacterial culture onto each LB agar plate, frozen glycerol stocks may also be utilized and directly delivered onto the plate.
3. Spread the 100 μl overnight bacterial culture with the sterile cell spreader making sure not to disrupt (break) the agar surface
4. Incubate at 37°C for 4-6 hr, or until a thin lawn of bacterial growth becomes distinguishable. Cells are most competent when actively growing
5. Harvest the bacteria with a sterile inoculating loop. One 2 mm diameter bacterial mass is sufficient for a single transformation
6. Resuspend the bacterial mass in 1mL sterile ddH₂O (for E. coli) and mix well until no clumps are visible, keep on ice
7. Centrifuge each bacterial suspension for 5 min at 5,000 x g in an environment of 4oC
8. Discard the supernatant, resuspend the bacterial pellet in the same volume of ice-cold sterile ddH2O, centrifuge again and repeat for three times the washing process
9. Remove supernatant, resuspend, and then loosen the bacterial pellet thoroughly in 40 μl ice cold 2 mM CaCl₂ or sterile ddH₂O and keep on ice
10. Add up to 1 μg of plasmid DNA (in up to 1 μl ddH2O) to the 40 μl bacterial suspension and transfer this mixture into a pre-chilled, sterile 0.2 cm gap cuvette. Cold cuvette improves cell viability. DNA must have a low amount of salt
11. Insert the cuvette into the electroporation chamber of the pulse control module, and electroporate at 1.8 kV, 25 μF. The time constant should be ~5.0 msec, and no arcing should occur. Electroporation needs to be carried out immediately after adding DNA
12. Quickly recover the cell suspension by resuspending into 1 ml LB broth and transfer into previously autoclaved test tube
13. Allow the cells to recover by incubating under aerated growth conditions (in a roller drum) at 37 °C for 30 min without antibiotic selection
14. Plate the bacteria onto the previously prepared LB agar plates in the presence of the appropriate selective agent (antibiotic), and incubate at 37 °C overnight

Bacterial Expression ⁷

Materials

• Transformed E. coli
• LB medium
• Terrific Broth (TB) medium
• Inducer (see experimental design)
• Incubator

Methods Note: Specific incubation times and concentrations are mentioned in (see experimental design). This is the template protocol used for all transformed E. coli induction.

1. Three single colonies of bacteria which have been successfully transformed are incubated into 4mL of LB medium each (containing respective antibiotic with 1:1000 ratio) and shake in the incubator (37°C) for 14-16 hours
2. From each of the overnighted LB medium, take 100 μL of bacterial culture and place it into new 10 ml of TB medium (containing respective antibiotic with 1:1000 ratio)
3. Shake in the incubator (37°C) for 2 hours
4. After 2 hours, isolate 1 ml of liquid medium for SDS-PAGE
5. Add an inducer and incubate respective to the transformed parts (see experimental design)
6. Isolate 1 ml of the liquid medium for SDS-PAGE (and other test) every n-time (see experimental design)

Plasmid Isolation ¹

Materials

• P1, P2, N3, PB, and EB Buffer (Qiagen)
• Transformed E. coli
• LB medium

Methods

1. Grow bacterial culture in 15 mL conical centrifuge tube with 4-5 mL Luria-Bertani (LB) medium with inoculating the replica result, incubate at 150-200 rpm for 14-16 hours at 37°C
2. Harvest the cells by centrifuge the tube at 3500 rpm speed for 10 minutes
3. Decant the supernatant by vertically flipping the tube
4. Resuspend the pellet with 125 μL (250 μL for bigger scale) P1 buffer, and then shake with hands)
5. Add 125 μL of P2 buffer and mix until well for 7-8 times. (Do not do this step for more than 5 minutes)
6. Add 175 μL of N3 buffer and mix it immediately, gently homogenate for 7-8 times
7. Centrifuge the tube in balance to avoid vibration at 12000 rpm for 1 minute at 4°C
8. Take all of the supernatant and put it into the blue column with a micropipette (make sure to not take the pellet at all because it will clog the column membrane)
9. Centrifuge the tube in balance to avoid vibration at 12,000 rpm for 1 minute at 4°C
10. Take all the fluid below the blue column, and put it again into the blue column
11. Centrifuge the tube in balance to avoid vibration at 12,000 rpm for 1 minute at 4°C (after this step, all of the plasmid trapped in the membrane)
12. Remove all the fluid below the blue column. Wash the blue column by adding a 200 μL PB buffer
13. Centrifuge the tube in balance to avoid vibration at 12,000 rpm for 1 minute at 4°C
14. Remove all the fluid below the blue column. Wash the blue column by adding 500 μL PE+Ethanol buffer (Mixture of PE Buffer and Ethanol with 1:4 ratio)
15. Centrifuge the tube in balance to avoid vibration at 12,000 rpm for 1 minute at 4°C
16. Remove all the fluid below the blue column, and repeat Step 15 once again to make sure there is no buffer left in the membrane (PE+Ethanol Buffer can cause damage to the plasmid)
17. Remove all the fluid below the blue column, put the blue column into the new microfuge tube Add 20 μL of ⅓ EB Buffer (Mixture of EB Buffer and Sigma water with 1:3 ratio) to the blue column. Centrifuge the tube in balance to avoid vibration at 12,000 rpm for 1 minute at 4°C
18. Add another 15 μL of ⅓ EB Buffer to the blue column. Centrifuge the tube in balance to avoid vibration at 12,000 rpm for 1 minute at 4°C
19. Remove the blue column, and store the isolated plasmid in the 4°C freezer

Ni-NTA Affinity Chromatography Purification ⁸

Materials

• Buffer (300 mM NaCl, 50 mM NaH₂PO₄, pH to 8.0 with NaOH)
• 50% Ni²⁺–NTA slurry (Qiagen)
• 10 mM imidazole
• HCl

Methods

1. Lyse cells express the tagged protein by sonication on ice in the loading buffer (300 mM NaCl, 50 mM NaH2PO4, pH to 8.0 with NaOH). Approximately 3–5 ml of loading buffer should be used per gram (wet weight) of cells. Keep the lysate as cold as possible to minimize possible proteolysis
2. Centrifuge lysate by spinning at 12,000 rpm for 30 min at 4°C
3. Add 50% Ni2+–NTA slurry (Qiagen) pre-equilibrated in an ice-cold loading buffer to the supernatant. Add a sufficient amount of 50% Ni2+–NTA slurry to bind the polyhistidine-tagged protein (5–10 mg/ml resin). Stir or rotate at 4°C for 1 hr
4. Load the resin onto a column. Wash the resin with 20 column volumes of loading buffer at 4°C
5. Wash the resin with 20 column volumes of wash buffer at 4°C (same as loading buffer but also containing 10 mM imidazole, pH to 8.0 with HCl)
6. Elute with a 20 column volume gradient of 10 to 250 mM imidazole in loading buffer (pH to 8.0 with HCl). Collect 1-ml fractions and assay for fractions containing the desired protein using SDS–PAGE

SDS-Polyacrylamide Gel Electrophoresis (SDS-PAGE) ¹

A. Standard SDS-PAGE

Materials

• Polyacrylamide 30%
• Sodium dodecyl sulfate 10% (SDS 10%)
• Tris-HCl 1.5 M pH 8.8 solution
• Tris-HCl 0.5 M pH 6.8 solution
• Ammonium persulfate 10% (APS 10%)
• TEMED
• Tank Buffer 10% containing tris base, glycine, and SDS
• Bio-Rad Mini-PROTEAN Tetra Cell

Methods

1. Set up the glass plates using Bio-Rad Mini-PROTEAN Tetra Cell kit based on the Bio-Rad protocol
2. Prepare the resolving and stacking gel solution according to the desired concentration with the help of Bio-Rad Mini PROTEAN Tetra Cell kit
   
   1. Resolving Gel

      Components	Gel Concentration (%)
      	15	12	10	7
      Tris-HCl 1.5M pH 8.8	1.75 ml	1.75 ml	1.75 ml	1.75 ml
      Polyacrylamide 30%	3.5 ml	2.8 ml	2.333 ml	1.633 ml
      Distilled water	1.638 ml	2.338 ml	2.8047 ml	3.5047 ml
      SDS 10%	70 µl	70 µl	70 µl	70 µl
      APS 10%	35 µl	35 µl	35 µl	35 µl
      TEMED	7 µl	7 µl	7 µl	7 µl

   2. Stacking Gel

      Components	Volume
      Tris-HCl 0.5 M pH 6.8	0.75 ml
      Polyacrylamide 30%	0.4 ml
      Aquades	1.812 ml
      SDS 10%	30 µl
      APS 10%	15 µl
      TEMED	3 µl

3. Stacking GelPrepare the protein sample mixed with loading buffer by heating at 100°C for 10 minutes then centrifuge at 12.000 rpm for 1 minute
4. Put the gel into the SDS PAGE Tank with Bio-Rad Mini PROTEAN Tetra Cell kit
5. Fill the SDS PAGE Tank with tank buffer 10%
6. Insert 15-20 µl of each sample into the wells
7. Install the lid and connect it to the power supply
8. Adjust the settings to 150 V, 400 mA and run for 60-90 minutes
9. Open the glass carefully and put the gel into distilled water
10. Stain the gel with PageBlue Staining Solution for approximately 1 hour
11. Wash the gel by soaking it in distilled water overnight

B. Tricine Gel Electrophoresis

Materials

• Acrylamide, bisacrylamide, Tris base, Tricine, TEMED
• Ammonium persulphate, glycine, glycerol, urea
• PageBlue staining (Thermo Fisher)
• Mini-PROTEAN Tetra Cell gel cassette, PowerPac Basic power supply and Polypeptide SDS-PAGE Standards (Bio-Rad Laboratories)
• Multicolor broad range protein ladder (Cat#26634)
• SuperSignal West Pico Chemiluminescent Substrate (Prod#34077 Thermo Scientific)

Methods

1. Separation gels with different concentration of monomers (acrylamide and bisacrylamide) and percentage concentration of the cross linker relative to the total concentration, which were afterwards indicated with T and C, respectively, were prepared
2. The acrylamide-bisacrylamide (AB)-3 stock solution (T=49.5%, C=3% mixture) was prepared by dissolving 48 g acrylamide and 1.5 g bisacrylamide in 40ml water and then adding water up to 100ml. The acrylamide-bisacrylamide (AB)-6 stock solution (49.5%T, 6%C mixture) was prepared by mixing 46.5 g acrylamide and 3 g bisacrylamide in 40 ml water and then adding water up to 100 ml
3. Fixing solution, used for PageBlue staining, was prepared by adding 500ml methanol, 100ml acetic acid and 7.708g ammonium acetate to 400ml water
4. Staining solution was prepared by mixing 100ml acetic acid, 20 mL PageBlue dye and 900ml water
5. The destaining solution was 10% acetic acid solution(v/v). 80% glycerol (v/v) was prepared by diluting 80ml glycerol in 20ml water
6. 10%SDS solution (w/v) was obtained by dissolving 0.1g SDS in 100ml water
7. 10% ammonium persulfate solution (w/v) was prepared by dissolving 0.1g ammonium persulphate in 1ml water, effective for 1 week
8. Electrode and gel buffers for Tricine-SDS-PAGE were prepared as indicated in the table
9. Electrode buffer (10) of Glycine-SDS-PAGE was prepared by dissolving 30.03g Tris, 188g glycine and 10g SDS in 1L water
10. Diluted it in a 1:10 ratio to water when used for electrophoresis
11. All solutions should be stored at room temperature, except that the acrylamide and bisacrylamide mixtures were kept at 7-10°C after filtration, to avoid crystallization at 4°C
12. Composition for minigel was calculated referring to Tricine-SDS-PAGE protocol for large gels with modification, which was optimized by selecting ideal compositions from three concentration levels of urea (6, 4.2 and 2.8M), and two mass-volume concentration levels of glycerol(10% and 13.3%)
13. To compare the effect of two glycerol concentration levels, Tricine-SDS gels of 10% and 13.3% glycerol(w/v), both of them with 18%T, 3%C separating gel, were casted, while 18%T, 6%C separating gels with urea concentration levels of 2.8, 4.2 and 6M were also casted to optimize urea concentration in minigels
14. After optimizing the concentration of glycerol and urea, five concentration levels of acrylamide-bisacrylamide (5%T, 3%C; 10%T, 3%C; 18%T, 3%C; 18%T, 6%C; 18%T, 6%C) were used to optimize the analytical electrophoresis condition
15. The separating gel was overlaid with several drops of water, then left for about 1 hour to polymerize adequately, finally the overlaid water was replaced by a 5%T, 3%C stacking gel
16. Add a cathode buffer as the inner electrode buffer and anode buffer as the lateral electrode buffer
17. Polypeptide SDS-PAGE standards (Bio-Rad) comprised six proteins, covering the mass range of 1.4-26.6kDa. Approximately 0.5-2μg per protein band was needed for visualization after being stained by PageBlue. The concentration of polypeptide standards was about 8μg/μl
18. For partial elution during the staining-destaining procedure, an amount of 4μg proteins per well was applied for all Tricine-SDS gels, including the gels used to optimize the concentration of glycerol and urea. Mix 0.5μl protein standards with 4.5μl protein loading buffer as a loading sample. The mixture was incubated at 95℃ for 5 min and then loaded under the cathode buffer
19. The electrophoresis was operated at room temperature without any cooling measure except for heat conduction by the surrounding air
20. All running conditions were set at 60V initially and maintained at this voltage until the samples completely entered the lower separating gel
21. The next voltage steps were set at 100V for 1.0mm 10%T gel and 140V for 1.0mm 18%T gel. The relative electrophoretic mobility of all the proteins, exported by Quantity One software, was used to plot calibration curves
22. Stain them with PageBlue

Culturing H. pylori⁹

Two types of culture media, agar (Columbia agar) and liquid (Brucella broth), are used. Preferable system atmosphere of 10% CO₂, 5% O₂, and 85% N₂ is achievable through Oxoid-Campygen system. We used H. pylori of strain ATCC 49503.

Materials

• H. pylori ATCC 49503
• Oxoid Anaerobic jar (Thermo-Fisher)
• Campygen CN0025 (Thermo-Fisher)
• Agar-based medium

1. Columbia Blood Agar Base (Neogen Corporation): dissolve 21.5 g in 500 mL bottle of H2O and autoclave
2. 5% Defibrinated Horse Blood (Hemostat Laboratories)
3. 1,000× Antibiotic stock: dissolve 100 mg Trimethoprim (Sigma) and 160 mg Amphotericin B (Amresco Inc) in 20 mL dimethyl sulfoxide (DMSO) (Sigma). Store 1 mL aliquots at −20°C
4. 200× Antibiotic Stock: dissolve 100 mg Vancomycin Hydrochloride (Amresco Inc), 50 mg Cefsulodin Sodium Salt (Sigma), and 3.3 mg Polymyxin B Sulfate (Sigma) in 50 mL of H 2 O and sterilize with a 0.22 μ m filter. Store 5 mL aliquots at −20°C
5. β -Cyclodextrin (Sigma): dissolve 1 g in 5 mL of DMSO. This solution must be made immediately before adding to the agar solution and should not be stored
6. N-acetylcysteine 2 mg/ml (for biofilm inhibition)

• Liquid-based medium

1. Brucella broth: dissolve 28 g in 1 L H2O and autoclave. Store at room temperature
2. 10% Fetal Bovine Serum (FBS) (Gibco/Invitrogen, Carlsbad, CA, #10437-028)
3. Vancomycin Hydrochloride solution: dissolve 100 mg in 10 mL of H2O and sterilize with a 0.22 μm filter. Store 1 mL aliquots at −20°C
4. N-acetylcysteine 2 mg/ml (for biofilm inhibition)

Methods

1. Culture with Biofilm formation (Agar Based)
   1. Preparations
      1. After autoclaving the Columbia Blood Agar, place the bottle in a 55°C water bath and allow the temperature of the agar to equilibrate.
      2. Remove the agar from the water bath and swirl the bottle to evenly distribute the agar
      3. Add 500 μ L of 1,000× Antibiotic stock to the agar
      4. Add 2.5 mL of 200× Antibiotic stock to the agar
      5. Add 5 mL of β -cyclodextrin solution to the agar
      6. Add 25 mL of Defibrinated Horse Blood to the agar
      7. Pour the blood agar into petri dishes such that it covers the bottom of the plate taking care to avoid bubbles
      8. Allow the plates to cool and solidify at room temperature overnight
      9. Store the plates in sealed plastic bags at 4°C
   2. Patch Growth of H. pylori
      1. Remove plates from the refrigerator and allow them to reach room temperature
      Using a sterile pipet tip, remove a small chunk of bacteria from the freezer stock
      2. Spread the chunk onto the blood agar plate over a small quarter-sized area, allowing it to melt and briefly dry
      3. Place the plate in an anaerobic jar
      4. Attach the jar to the anaerobic jar and allow it to evacuate and replace the gas in the jar to create a microaerophilic atmosphere consisting of 5% O₂, 10% CO₂, and 85% N₂
      5. Place the jar in a 37°C incubator overnight
   3. Lawn Growth of H. pylori
      1. Remove patched Helicobacter cells grown as above using a sterile cotton swab
      2. Resuspend the cells in Brucella Broth
      3. Take the swab and spread the resuspended cells evenly over the entire surface of a new blood agar plate
      4. Allow the plate to briefly dry, invert it, and place it in an Oxoid jar and evacuate as described above
      5. Place the jar in a 37°C incubator overnight
   4. Colony Growth of H. pylori
      1. Remove lawned Helicobacter cells using a sterile cotton swab
      2. Resuspend the cells in 1 mL of Brucella Broth
      3. Place sterile glass beads onto a new blood agar plate
      4. Pipette 1–10 μ L of the bacterial suspension onto the plate
      5. Shake the plate horizontally in several directions to distribute the beads and suspension across the plate
      6. Pour the beads off of the plate
      7. Allow the plate to briefly dry, invert it, and place it in an Oxoid jar and evacuate as described above
      8. Place the jar in a 37°C incubator. Colonies typically form in 4–7 days


2. Culture with Biofilm Formation (Liquid Based)
   1. Prepare the Brucella Broth as described above and allow it to reach room temperature
   2. Place 18 mL of Brucella Broth, 2 mL of FBS, and 20 μL of the 10 mg/mL vancomycin stock solution in a 125 mL screw-top flask and swirl to mix
   3. Remove lawned Helicobacter cells using a sterile cotton swab
   4. Resuspend the cells in Brucella Broth
   5. Pipette the resuspended bacterial cells into the flask containing the liquid media prepared as described above until it appears slightly cloudy
   6. Swirl the liquid culture to distribute the bacterial cells
   7. Place the liquid culture in a micro-aerobic environment and evacuate as described above
   8. Place the jar in a 37°C shaking incubator set with rotations of 100 rpm overnight


3. Culture without biofilm formation (Agar Based)¹²
   1. After autoclaving the Columbia Blood Agar, place the bottle in a 55°C water bath and allow the temperature of the agar to equilibrate
   2. Remove the agar from the water bath and swirl the bottle to evenly distribute the agar
   3. Add 500 μ L of 1,000× Antibiotic stock to the agar
   4. Add 2.5 mL of 200× Antibiotic stock to the agar
   5. Add 5 mL of β -cyclodextrin solution to the agar
   6. Add 25 mL of Defibrinated Horse Blood to the agar
   7. Add an increasing concentration of NAC broth (2, 10, and 20 mg/mL) to assess biofilm quantity
   8. Pour the blood agar into petri dishes such that it covers the bottom of the plate taking care to avoid bubbles
   9. Allow the plates to cool and solidify at room temperature overnight
   10. Store the plates in sealed plastic bags at 4°C


4. Culture without biofilm formation (Liquid Based)¹⁰
   Step 2-4 is for the control, to see whether or not NAC could repress biofilm formation.
   Step 1 prevents biofilm formation from the beginning.
   
   1. Add cultured H. pylori with NAC 2 mg/mL. Both NAC-containing and NAC-lacking trays were tested for biofilm formation as described
   2. After the growth of H. pylori culture, NAC-lacking trays were then tested, in 2 different plates, upon addition of increasing concentration of NAC broth (2, 10, and 20 mg/mL) to assess biofilm quantity
   3. Enumerate bacteria with Petroff-Hauser counter. Cultures were adjusted to 5 × 107 cells/ml, and 1 to 2 ml was inoculated per well into six-well microtiter trays
   4. Each well also contained a sterile 25-mm borosilicate coverslip that had been placed at an angle in the chamber in order to allow biofilm formation at the air-liquid interface, and the cultures were gently shaken on an orbital shaker for 2 to 6 days

Crystal Violet Staining^10,11

Materials

• H. pylori strain ATCC 49503
• Brucella broth (BB)-10% FBS liquid medium
• Phosphate-buffered saline (PBS)
• Methanol
• Gram's crystal violet solution (Sigma-Aldrich)
• Differentiation solution (Sigma)
• Well plate
• Anaerobic jar

Methods

1. Starter cultures were used to inoculate 1 ml of liquid medium per well to an optical density (OD) of 600 of 0.1 ODU
2. Three separate well plates were used for time points T₂₄, T₄₈, and T₇₂ hours. Plates were grown at 37°C
3. At each time point, the medium was aspirated, and each well was washed two times with phosphate-buffered saline (PBS)
4. Plates were dried for 5 min at 37°C, and biofilms were subsequently fixed with methanol (J.T. Baker) for methanol fixation
5. One percent Gram's crystal violet solution (Sigma-Aldrich) was then added to each well until full (approximately 2 ml), including one empty control well to serve as a blank. Plates were incubated for 15 minutes
6. Following incubation, wells were washed with distilled water and air dried for 5 min at 37°C, and then crystal violet was solubilized with a differentiation solution (Sigma-Aldrich) for 15 min
7. To quantify biofilm formation, solubilized crystal violet solution was read at an absorbance of 590 nm (OD₅₉₀) for each sample

Bactericidal Activity¹²

Materials

• H. pylori ATCC 49503
• Columbia blood agar
• Brucella broth
• Purified expressed PGLa-AM1

Methods

1. H. pylori prepared with a turbidity equivalent to two standard McFarland after cultured in blood agar culture medium in microaerophilic jar for 72 h at 37°C
2. Brucella broth is prepared with different PGLa-AM1 concentrations respective to incubation time (see Culturing H. pylori )
3. 100 μL of H. pylori (10^6 CFU) is added to each Brucella broth and cultured at 37 °C for 0, 5, 15, 30, 45, and 60 mins.
4. After each period, cultures are tenfold diluted to 1/10,000 concentration
5. 20 μL of the diluted cultured in 3. are mixed into 180 μL of fresh Brucella broth. 50 μL of the resulting solution is plated on Brucella agar supplemented with 10% FBS
6. Plate is cultured in microaerophilic jar for 72 h at 37°C
7. After final culture, bacterial clones are counted (CFU/mL)

PGLa-AM1 and Proteinase K interaction quantification

Materials

• PGLa-AM1
• Proteinase K
• H. pylori culture
• AEBSF
• Brucella broth

Methods

1. Into several preparations of Brucella broth, pipette PGLa-AM1 until a concentration of 32 mg/ml is reached
2. Each Brucella broth preparation with PGLa-AM1 is incubated at 25 °C for 0.5, 1, 2, 3, 5, and 6 hours with 50 µg/ml of proteinase K
3. At the allotted time, pipette AEBSF into each Brucella preparation until a concentration of 1 mM is reached
4. The Brucella broth is then used for bactericidal assay (Bactericidal Assay)

References

1. Team:UI Indonesia/Experiments - 2019.igem.org [Internet]. [cited 2021 Oct 20]. Available from: https://2019.igem.org/Team:UI_Indonesia/Experiments
2. Addgene: Gibson Assembly Protocol [Internet]. [cited 2021 Oct 20]. Available from: https://www.addgene.org/protocols/gibson-assembly/
3. Addgene: Protocol - Bacterial Transformation [Internet]. [cited 2021 Oct 20]. Available from: https://www.addgene.org/protocols/bacterial-transformation/
4. Elbing, K. L., & Brent, R. (2019). Recipes and Tools for Culture of Escherichia coli. Current protocols in molecular biology, 125(1), e83. https://doi.org/10.1002/cpmb.83
5. Huynh, Hien & Couper, Richard & Tran, Cuong & Moore, Lynette & Kelso, Richard & Butler, Ross. (2004). N-Acetylcysteine, a Novel Treatment for Helicobacter pylori Infection. Digestive diseases and sciences. 49.
6. Addgene: Protocol - How to Inoculate a Bacterial Culture [Internet]. [cited 2021 Oct 20]. Available from: https://www.addgene.org/protocols/inoculate-bacterial-culture/
7. Shen, P., Niu, D., Permaul, K., et al. (2021). Exploitation of ammonia-inducible promoters for enzyme overexpression in Bacillus licheniformis. Journal of Industrial Microbiology & Biotechnology, 48: 5-6.
8. Bornhorst, J. A., & Falke, J. J. (2000). Purification of proteins using polyhistidine affinity tags. Methods in enzymology, 326, 245–254.
9. Whitmire, J. M., & Merrell, D. S. (2012). Successful culture techniques for Helicobacter species: general culture techniques for Helicobacter pylori. Methods in molecular biology (Clifton, N.J.), 921, 17–27.
10. Cammarota, G., Branca, G., Ardito, F., Sanguinetti, M., Ianiro, G., Cianci, R., Torelli, R., Masala, G., Gasbarrini, A., Fadda, G., Landolfi, R., & Gasbarrini, G. (2010). Biofilm demolition and antibiotic treatment to eradicate resistant Helicobacter pylori: a clinical trial. Clinical gastroenterology and hepatology : the official clinical practice journal of the American Gastroenterological Association, 8(9), 817–820
11. Servetas, S. L., Carpenter, B. M., Haley, K. P., Gilbreath, J. J., Gaddy, J. A., & Merrell, D. S. (2016). Characterization of Key Helicobacter pylori Regulators Identifies a Role for ArsRS in Biofilm Formation. Journal of bacteriology, 198(18), 2536–2548.
12. Zhang, X., Jiang, A., Wang, G., Yu, H., Qi, B., Xiong, Y., Zhou, G., Qin, M., Dou, J., & Wang, J. (2017). Fusion expression of the PGLa-AM1 with native structure and evaluation of its anti-Helicobacter pylori activity. Applied Microbiology and Biotechnology, 101, 5667-5675.
13. Sarafnejad, A., Siavoshi, F., Safaralizadeh, R., Masarat, S., Khosravi, F., Malekzadeh, R., Nikbin, B., Salehi-Nodeh, A. R. (2007). Assessment of Helicobacter pylori Viability by Flow Cytometry. Iran J Public Health. 1;36(1):50-54.