How Project Cargo can Help Build Better Vaccines
Here we will discuss how Project Cargo can be implemented in the real world to improve vaccine design.
mRNA technology is likely to be the future of rapid-development vaccines. A problem with the Moderna and Pfizer covid vaccine was the widespread side effects felt after the second dose. After the first dose, the body is primed to attack the spike protein created from the second dose. This heightened response causes the achy-fever inflammation repose.
As a solution, UC Davis iGEM 2021 created a software suite that will take your desired mRNA vaccine and insert an mRNA stem-loop sequence in the most favorable place based on steric modeling. This software is called Foldase, and once run, the software provides the best candidates in optimal range to slow translation when transiently expressed in the mammalian system. As the Iron Responsive Element is taken from the human ferritin 5’UTR, we can say tentatively that our system will show similar results in human cells as in hamster cells.
Researchers interested in translation regulation in human cells can add our 5’UTR upstream of any transient expression insert.
Sequence
Wildtype IRE (Human Ferritin): GATCCTGCTTCAACAGTGCTTGGACGGACGGATCTT
5’-GGGAAATAAGAGAGAAAGATCCTGCTTCAACAGTGCTTGG ACGGACGGATCTTAGAAGAGTAAGAAGAAATATAAGACCCCGG CGCCGCCACC -3’
Another part we made for researchers to use is a VSVG-P2A-H2B-YFPdd transient expression system. This can be viewed in the experimental design page.