Contact

Parts

The main components used by the team this year mainly involve the construction and expression of 4 keratinases, including 4 basic parts and 4 composite parts. Other parts includes the improved composite part of KERA with about 10 orders of magnitude higher than before, which was used in several previous team realative to keratinases. Also, the main part of last years' SZ_SHD team was improved to be expressed in plant cells. Detailed description can be checked in specific part pages.

	Basic parts	Composite parts
KerAVDZ50	BBa_K3895003	BBa_K3895009
KerBIER15	BBa_K3895004	BBa_K3895008
KerBIMKU3	BBa_K3895005	BBa_K3895010
KerBteQ7	BBa_K3895006	BBa_K3895007
Insecticidal protein	BBa_K3686010	BBa_K3895012
T7 promoter	BBa_I719005
Terminator	BBa_B0012
E. Coli CreABCD phosphate sensing operon promoter	BBa_J64951
5' UTR/RBS_KerA	BBa_K3895013
6xHis-tag	BBa_K3895014
KeratinaseA	BBa_K1717171
L3S3P21_3' UTR/Terminator	BBa_K3895015
Optimized KerA		BBa_K3895016

Keratinases kerAvDZ50 (BBa_K3895007), kerBteQ7 (BBa_K3895008), kerBlMKU3 (BBa_K3895009), and kerBlER-15 (BBa_K3895010) were expressed by T7 promoter. The sequences were constructed into PET 28a(+) plasmids and transformed to E.coli BL21 (DE3).
PCR was conducted first for verification of the correct plasmids. Then the amplified DNAs were sequenced (forward primer: TCGATCCCGCGAAATTAATACG; reverse primer: AGGGGTTATGCTAGTTATTGCTCA) and compared with the designed DNA sequences for further verification.
Further steps done on electropherosis has shown the length between 1000 bp to 2000 bp, which indicates the approximately correct length compared to our target plasmid.
KerAvDZ50: 1217 bp
KerBIER15: 1175 bp
KerBIMKU3: 1202 bp
KerBteQ7: 1214 bp

Figure 1. Results of PCR and SDS-PAGE verification of the four keratinases.

Concentrations for IPTG induced expression:

KerAVDZ50: 0.67139 mM (160 µL/mL)
KerBIER15: 0.4196 mM (0.01% w/v)
KerBIMKU3: 0.4 mM
KerBteQ7: 5 mM

Name of keratinase	IPTG concentration/mM	Temperature/°C	Time/h
KerBteQ7	5	16	12
KerAVDZ50	0.67139	16	12
KerBIER15	0.4196	37	16
KerBIMKU3	0.4	37	4

Figure 2. Enzyme activity of KU3 on casein, gelatin and BSA.

Figure 3. Enzyme activity of Q7 on casein, gelatin and BSA.

Figure 4. Enzyme activity of R15 on casein, gelatin and BSA.

Figure 5. Enzyme activity of Z50 on casein, gelatin and BSA.

Figure 6. Protease activity of 4 keratinases on different natural substrates at 30 min of incubation, pH 7.5. The degree of action of keratinase on the substrate is in the order of BSA, casein, and gelatin, OD (A660) detected via Folin-Ciocalteu's phenol reagent. KU3, Z50 and Q7 all showed a relatively high enzyme activity among 4 keratinases at a higher concentration (100mg/ml) on the three substrates (casein, BSA and gelatin). Whereas, the activity of Z50 is relatively lower at a lower concentration (<50 mg/ml), compared with KU3 and Q7.

Optimized keratinase KerA

Introduction

Click here to download the information about our dataset

The composite part BBa_K1717171 is an optimized version of KERA that can be constructed into pSB1C3 plasmid with the highest protein expression in E.coli BL21(DE3). The KERA is a basic part comprised from a synthesized KERA protein coding sequence. The gene can be expressed in cells by looking for clear areas of cell growth on AGAR plates of skimmed milk, and by observing keratin-containing substrates (feathers, hair, chemosynthetic keratin, etc.) growing with cells.

Plasmid Construction

Figure 7. The construction of optimized KERA on pSB1C3 backbone, with 6xHis-tag for purification. The combination of promoter, RBS, and terminator is with the best performance in expression.

Experiment details

• Throughput: 2500
• Organism: E. coli
• Strain type: BL21(DE3)
• Temperature: 37°C
• Media: 250 ml LB
• Period of time: 16 hours
• Plasmid backbone: pSB1C3
A. Vec platform was used to test the expression of KERA in more than 2000 random expression vectors. Different regulatory elements used in the vector can result in nearly 10 orders of magnitude difference in KERA expression.

Figure 8. The data plot of KERA optimization. Within more than 2000 protein yields, the final relative unit of the expression vector is about 10 orders of magnitude higher than before.

Insecticidal protein (BBa_K3895012)

Bt toxins refer to the toxic proteins produced by insect pathogenic bacteria Bacillus thuringiensis[1]. This part was adjusted from SZ-SHD 2020's bt toxin Cry7Ca1 (BBa_K3686010) for tobacco wheat instant expression, where Cry7Ca1 is a differentiate of Bt toxins with a molecular mass of 129kDa, recently isolated from Bt strain BHT-13. Cry7Ca1 is connected with GFP (BBa_E0040),and constructed into pCAMBIA1301 vector.