Generall Page

Background

Design

Modern civilization is heavily dependent on oil production and during the process of crude oil extraction and transport accidents with spills take place. It endangers flora, fauna and balance of the established ecosystem. As Kazakhstan is one of the countries whose economy relies on oil production and oil spills accidents take place frequently, we have decided to focus on a project which facilitates the bioremediation of oil spills and minimizes the environmental consequences of oil production.

Rhamnolipids are natural surfactants that help to decrease surface tension between formed oil film and the water. They form micelles together with oil, decomposing large oil spills into smaller droplets that are easily accessible for degradation by endogenous oil degrading bacteria. It is biodegradable, less toxic to producing bacteria, and shows high performance at extreme conditions such as high temperatures and aberrant pH changes (Gong et al., 2015). The given characteristics favors application of rhamnolipid over chemical biosurfactants at sites of spills. However, due to the cost of production on a big scale, preference is given to the synthetic biosurfactants.

Overall flow of the experimental design

How increased rhamnolipid production was achieved?

The rhlA gene codes for the enzyme RhlA, which forms the 3-hydroxydecanoyl-ACP dimer known as 3-(3-hydroxyalkanoyloxy) alkanoic acid (HAA) (Zhu et al., 2008 and Déziel et al., 2003). The second reaction, implicating the membrane-bound RhlB rhamnosyltransferase (coded by rhlB gene), uses dTDP-L-rhamnose to add the first rhamnose moiety to an HAA molecule, thus forming a mono-rhamnolipid (Figure 1).

The nadE gene codes for NH3-dependent NAD synthetase (UniProt, n.d.). It is an enzyme that catalyzes the ATP-dependent formation of NAD. Specifically, it is involved in converting deamido-NAD+ into NAD with the aid of ATP and an ammonium ion (Figure 2).

The NAD+ oxidation result is NADH which can be obtained by glycolysis, Krebs cycle, and β oxidation of fats. Thus, more available NAD+ can lead to faster substrate catabolism.

Moreover, after NAD reduction, NADH interacts with the electron transport chain where it releases one electron and one proton. As an electron moves, more protons exit the bacterial membrane which increases the proton gradient. Finally, to reach equilibrium, protons enter the cell by ATP synthase, and one proton can generate up to 3 ATP molecules this way (Figure 3). Thus, one NADH that releases one proton can generate 3 ATP molecules (Alberts et al., 2015). Produced ATP molecules are used for gene expression including rhamnolipid production and bacterial growth.

Finally, NAD+ can interact with NAD kinase to convert into NADP+ which plays a direct role in biosynthesis of rhamnolipids (Alberts et al., 2015).

Therefore, NAD plays direct and indirect roles in generation and production of rhamnolipids and it serves as a good target to increase rhamnolipid production.

Furthermore, it was previously shown that single nadE expression in different non-nadE expressing strains of bacteria increased NAD(H/+) pull inside the cell by two factors (Yong et al., 2016). Thus, overexpression of nadE gene results in significant increase in intracellular electron flow. Furthermore, under electro fermentative conditions, those electrons can be transferred to anode. Meaning, the extracellular electron pool can also be increased.

For the given reasons, increased rhamnolipid production was decided to be achieved by overexpression of nadE gene under the implementation of electro fermentative conditions.

Figure 4. Schematic diagram of how *nadE* gene overexpression in *P. aeruginosa* leads to increase electron flow

Our ultimate goal is to show the effect of overexpression of nadE gene in Pseudomonas aeruginosa on the rhamnolipid production. P. aeruginosa is a strain carrying genes of our interest both nadE and rhlA/B. However, it has an ability to produce toxins, which can be dangerous for endogenous species of the sea and soil and local population directly contacting sites contaminated with crude oil [6]. However, we are not going to introduce P. aeruginosa to the sites of contamination. Instead, we are planning to show the model, where rhamnolipid production is elevated as a result of nadE gene overexpression (Figure 4). For the given study, RGPDuo2 plasmid (Figure 5) was used to incorporate nadE and rhlA, rhlB genes into P. aeruginosa (Liu, 1974).

Further studies can be done on non-toxic Pseudomonas putida KT2440 strain transformed with rhlA/B genes and whose rhamnolipid production is increased by overexpression of nadE gene. The rhamnolipids produced by the given modified strain can be used to decrease the surface tension between water and oil at the site of contamination.

Study models

To test the effect of nadE, rhlA, and rhlB genes overexpression in P. aeruginosa on rhamnolipid production, we have formed the following models:

P. aeruginosa wild-type
P. aeruginosa pRGPDuo2
P. aeruginosa pRGPDuo2 + nadE
P. aeruginosa pRGPDuo2 + rhlA
P. aeruginosa pRGPDuo2 + rhlB

P. aeruginosa wild-type and bacteria with plain RGPDuo2 plasmid would serve as controls. nadE, rhlA, and rhlB genes were inserted in MCS1, which increase expression of each gene in each model. We have expected that nadE overexpression will lead to increased ATP levels and thus elevated rhamnolipid production.

To obtain P. aeruginosa with genes of our interest we performed the following experiments.

Strain modification

Extraction of genes

First task was to extract nadE and rhlA/B genes from the Pseudomonas aeruginosa PAO1. For that purpose genomic DNA of P. aeruginosa was extracted and primers for amplification of genes of interest (nadE, rhlA and rhlB) were designed. Each primer consists of a non-specific sequence of 4 base pairs followed by a restriction site and sequence complementary to the insert gene. Figures 6-11 depict the primer sequence bound to the gene sequence.

Table 1. Design of primers for PCR amplification.
Primer name (name of the implifying gene_direction)	5’-3’ sequence(restriction site is highlighted in bold)	Enzyme cutting at the corresponding site
nadE_forward	agtcgtcgacacgggagcccgaacatgcaac	SalI
nadE_reverse	catagagctctcagggcgccttcggcagttcg	SacI
rhlA_forward	tagggtcgactttgggaggtgtgaaatgcggcgcga	SalI
rhlA_reverse	ataagagctcgtcaagggttcaggcgtagccgatggc	SacI
rhlB_forward	caaagtcgacttgcataacgcacggagtagccccatg	SalI
rhlB_reverse	actagagctccagcaccgttcaggacgcagccttcag	SacI

Figure 8. Forward primer for amplification of *rhlA*

Figure 9. Reverse primer for amplification of *rhlA*

Figure 10. Forward primer for amplification of *rhlB*

Figure 11. Reserve primer for amplification of *rhlB*

Restriction digestion of obtained genes of interestand ligation with the plasmid

Amplified gene products along with pRGPDuo2 were digested by restriction enzymes SalI and SacI and ligated. The schematic process of ligation is shown Figures 12-14.

Each gene (nadE, rhlA, and rhlB) was inserted into MCS1 of pRGPDuo2 which is located downstream of the IPTG-induciblePtac promoter. Therefore, the expression of the inserted genes in the plasmid pRGPDuo2 is regulated by the IPTG (isopropyl-β-d-thiogalactopyranoside).

Figures 15-17 illustrate the final plasmid with inserted genes of interest into the RGPDuo2 plasmid.

Figure 15. RGPDuo2 plasmid with inserted *nadE* gene at MCS1

Figure 16. RGPDuo2 plasmid with inserted *rhlA* gene at MCS1

Figure 17. RGPDuo2 plasmid with inserted *rhlB* gene at MCS1

Electrofermentation

We have used electrofermentative setup to compare electrochemical activity and charge output among engineered and wild-type strain of P. aeruginosa. The enzyme NH3-dependent NAD synthetase is overexpressed through the addition of nadE gene via plasmid, so NAD cofactor synthesis is expected to be elevated. The increase of NAD is correlated with higher electron flow (Yong et al., 2014), which is examined in this part of the experiment. The bio-electrochemical cells used in this experiment are aimed to induce higher growth rate and greater yield of cell products including rhamnolipids.

Wild type and engineered strains of P. aeruginosa were grown in bio-electrochemical cells with introduced graphite electrodes. To induce the expression of the inserted genes, the skimmed milk was used as a substitute for IPTG (Khani et al., 2020). All the samples had similar initial optical density and were incubated for 24 hours. The electro fermentative setup is shown in Figure 18.

Bioelectrochemical methods

Electrochemical activity of the strains were analysed by cyclic voltammetry (CV) through measuring oxidation and reduction potentials. The electroactivity was recorded at the initial and during 24-hour incubation time. CV analyses were run at 10 mV/s scan rates.

Chronoamperometric (CA) method was used to measure current output after incubation time. Chronoamperometric measurements were carried out with the working electrode poised at 400 mV and average current recorded every 60 s for a 24 h incubation time. CA data was used to quantify total charge after 24 hours for each type of strain.

Extraction and analyses of biosurfactant

Biosurfactant extraction

For the purpose of analysing biosurfactants, wild-type and engineered strains of P. aeruginosa were grown in the media with crude oil under conventional conditions for 24 hour at 35 °C. The cell-free supernatant from rhamnolipid production was precipitated. The precipitate was then air-dried and the masses of the samples were recorded.

Fourier Transform Infrared Spectroscopy (FTIR)

The product obtained from precipitation of cell-free supernatant was re-dissolved in distilled water. The samples were analysed by FTIR and obtained spectra were examined for the peaks indicating bonds present in rhamnolipid molecules. Those include the signature stretching of C-O-C bond indicating rhamnose sugar as well as ester, acidic, aliphatic, hydroxyl and carboxylate groups.

Bioremediation

Laboratory-scale bioremediation of soil saturated with crude oil

Soil samples contaminated with crude oil were used to set up a laboratory-controlled bioremediation. The cell-free supernatant from the samples grown under electro fermentative conditions were used. The five setups were constructed, four of which contained an equal amount of contaminated soil and an equal volume of the broth containing rhamnolipids produced by different strains. The fifth setup was used as a negative control and contained distilled water with the soil.

This experiment showed the remediation of the crude oil by the fermentation product of engineered P. aeruginosa strains which also was assessed by the emulsification index (Figure 19).

Emulsification index test (E24)

The setups from laboratory-scale bioremediation were used to find an emulsification index. The setups were shaken vigorously and allowed to rest. After 24 hours the tubes were visually examined and the emulsification index was calculated by the following formula:

$$E_{24}={\frac{H_{e}}{H_{t}}}*100$$

Where $$ E_{24}$$ = emulsification index following 24 h (in %);

$$H_{e}$$= emulsion height

$$H_{t}$$ = total height.

Reference List:

Gong, Z., Peng, Y. & Wang, Q. (2015) Rhamnolipid production, characterization and fermentation scale-up by Pseudomonas aeruginosa with plant oils. Biotechnol Lett 37, 2033–2038. https://doi.org/10.1007/s10529-015-1885-2

https://www.uniprot.org/uniprot/Q9HUP3 (Accessed on 17th October 2021)

Déziel, E., Lépine, F., Milot, S., & Villemur, R. (2003). rhlA is required for the production of a novel biosurfactant promoting swarming motility in Pseudomonas aeruginosa: 3-(3-hydroxyalkanoyloxy)alkanoic acids (HAAs), the precursors of rhamnolipids. Microbiology (Reading, England), 149(Pt 8), 2005–2013. https://doi.org/10.1099/mic.0.26154-0

Zhu, K., and Rock, C. O. (2008). RhlA converts beta-hydroxyacyl-acyl carrier protein intermediates in fatty acid synthesis to the beta-hydroxydecanoyl-beta-hydroxydecanoate component of rhamnolipids in Pseudomonas aeruginosa. Journal of bacteriology, 190(9), 3147–3154. https://doi.org/10.1128/JB.00080-08

Alberts, B. (2015) Molecular Biology of the Cell. 6th Edition, Garland Science, Taylor and Francis Group, New York.

Yong, X. Y., Feng, J., Chen, Y. L., Shi, D. Y., Xu, Y. S., Zhou, J., Wang, S. Y., Xu, L., Yong, Y. C., Sun, Y. M., Shi, C. L., OuYang, P. K., & Zheng, T. (2014). Enhancement of bioelectricity generation by cofactor manipulation in microbial fuel cell. Biosensors & bioelectronics, 56, 19–25. https://doi.org/10.1016/j.bios.2013.12.058

Liu, P. V. (1974). Extracellular Toxins of Pseudomonas aeruginosa. The Journal of Infectious Diseases, 130, S94–S99. http://www.jstor.org/stable/30081960

Khani, M.-H., & Bagheri, M. (2020). Skimmed milk as an alternative for IPTG in induction of recombinant protein expression. Protein Expression and Purification, 170, 105593. https://doi.org/10.1016/j.pep.2020.105593

CONTACT

igem@nu.edu.kz

Kabanbay batyr av., 53, Nur-Sultan, Kazakhstan

FOLLOW

Team:NU Kazakhstan/Design