# Inhibiting protein expression in E. coli
# Overview
In order to achieve the goal of high levels of expression of any target protein in the chassis organism and thus obtain the highest concentration (best purify without protein purification procedure) of the target protein, we need to globally inhibit all pbackground rotein expression except the gene of interest in E. coli.
# Engineering Cycle
# Design
Phages are known to be capable of reducing the expression of the chassis biological background proteins. We reviewed the literature and found that the T7 phage could achieve this through three proteins, gene protein (gp) 0.7, gp2 and gp5.7 . Gp0.7 and gp2 are proteins that function early during phage infection, while gp5.7 is a highly active protein in the middle of the phage infection. Phages can suppress the expression of native proteins early in the infection, and thus we believe that gp5.7 plays a complementary function to the gp2 protein, and that gp2 may has a stronger effect of reducing the background protein expression level. Therefore, we initially entailed gp2 in our circuits. As for gp0.7, it is reported as a broad-spectrum protein kinase and therefore can inhibit RNAP while interfering with the function of many other proteins, and we were aleither not sure if it would affect the target protein (Bst in our case). Besides, Gp0.7 has a large molecular weight. The host bacterium is under more stress when expressing it, so we did not select gp0.7. In contrast, gp2 is a relatively small molecular weight protein, with only 198 amino acids. For the above reasons, we chose gp2 to act as the inhibitor of background protein in our engineering bacteria.
However, leakage is also a severe problem that we predicted to encounter. To prevent the leakage of gp2 protein and inhibiting the growth of host bacteria before induction, we chose a medium copy of replication start and p15A Ori[1] and a low leakage promoter pBAD [2]. in our circuits.
# Build
We synthesized gp2 directly with Oligo Assembly for it is a small protein, P15A ori from the plysS plasmid, and pBAD sourced from the Distribution Kit our team received in 2019. we then used Overlab PCR and homologous recombination to ligate these fragments together and obtain a complete loop capable of fulfilling the intended function of the plasmid. In addition, to characterize the amount of heteroprotein, we obtained a plasmid with pCVD as a vector attached to a σ70 constitutive promoter controlling GFP expression. These two plasmids were cotransfected with Fast T1 E. coli (a modified version of DH5α) to obtain E. coli for culture.
Figure 1. araC-gp2-plysS
Figure 2. GFP-pCVD
# Test
We obtained E. coli successfully transformed with a functional plasmid and then cultured. We added 0, 10 mM, 1 mM, 0.1 mM, 0.01 mM arabinose at the absorbance OD600 of 0.2, and continued to incubate the bacteria, and measured the OD600 and GFP fluorescence intensity (excitation wavelength 488 nm, emission wavelength 530 nm) at half-hour intervals for 12 h. The results showed that the growth status and the expression of GFP in the bacterium under different level of induction were quite similar, indicating that the background protein has strongly inhibited the transcription of E. coli without induction,.We speculated that our anti-leakage measures failed to completely prevent the leakage of gp2.
Figure 3. Growth curve under different induction on gp2 expression (Mean±SD)
Figure 4. σ70 driven GFP expression under different level of arabinose induction on gp2 expression (Mean±SD)
# Learn
We learned that the function of gp2 was too strong that even minor leakage will severely affect the growth of our engineering bacteria.
To solve the problem that the repressor protein strongly inhibits E. coli transcription even without induction, due to its leakage expression, we can on the one hand try to optimize the anti-leakage element, and on the other hand, reduce the function of the repressor protein so that it won't cause notable effects when not induced even there's some leakage.
# Design
We think it's more practical to reduce the function of the repressor protein being expressed. To realize this, we chose gp5.7 to substitute for gp2, because gp5.7 is mainly a σS inhibitor, which can only slightly inhibit σ70.Even if the leakage of σS cause uncontrollable inhibition to transcription during growth plateau, it doesn't matter since the cell density has reached the up-limit. So, this design can well solve the problem of over-functioning transcriptional repressor protein.
# Build
We replaced the gp2 protein with gp5.7 protein and transfected E. coli along with other components.
Figure 5. araC-gp5.7-plysS
# Test
We obtained transfected E. coli after incubation under the same conditions and measured OD600 and GFP fluorescence intensity after arabinose induction. We found significant differences in the growth curve and GFP expression (no matter it's driven by σ70 or σS) of the organism without induction and with different concentrations of induction. It proved that we reached the goal that the expression of the native protein could be inhibited only by induction at specific concentrations.
Figure 6. Growth curve under different induction on gp5.7 expression (Mean±SD)
Figure 7. σ70 driven GFP expression under different level of arabinose induction on gp5.7 expression (Mean±SD)
Figure 8. σS driven GFP expression under different level of arabinose induction on gp5.7 expression (Mean±SD)
# Learn
Although the initial goal has been achieved, we can still try other anti-leakage methods to more precisely regulate the expression of gp5.7 protein.
# Detecting the infection of C. albicans
# Overview
In order to specifically detect Candida albicans, we used isothermal amplification to amplify their specific fragments for lateral flow assay.
# Engineering Cycle
# Design
Because of the small number of samples tested, we had to introduce an easily implemented isothermal amplification reaction to amplify the sample. Amplification reaction volume, only need to meet the minimum lower limit of the lateral flow assay test strips. Initially, we reasoned the primers for loop-mediated isothermal amplification (LAMP) were too complex to design and chose thermophilic helicase-dependent isothermal amplification (tHDA) for isothermal amplification to detect Candida albicans 5.8s rDNA.
# Build
tHDA primer1: 5-CTGGGTTTGGTGTTGAGCAATACGACT
tHDA primer2: 5-CCGCAAGCAATGTTTTTGGTTAGACCT
We purchased tHDA enzyme from NEB (#H0110S).
# Test
However, after more than two months of shooting and seeking help from various parties, including support from NEB, we still could not solve the problem that the signal of the amplification bands of the commercial tHDA kit was extremely weak and difficult to detect.
Figure 9. Results of commercial tHDA of Candida albicans 5.8s rDNA.
# Learn
When we contacted customer service, we were told that the tHDA amplification bands were just very weak and our experiments found it difficult to use the tHDA amplification products for subsequent LFA experiments, so we switched to other isothermal amplification methods.
Figure 10. Screenshot of the email from NEB customer service answering questions
We interviewed Prof. Yongming Wang, whose research interest includes combining LAMP with CRISPR Cas9 to carry out detections.
According to Prof. Wang’s insight, LAMP and RPA are potentially better alternatives to our tHDA method. When testing RNA viruses, rt-RPA was shown to yield false-positive results, while LAMP is relatively more sensitive and cost-efficient.
# Design
We noticed that tHDA requires two types of enzymes, decarboxylase, and polymerase, both of which are temperature sensitive - there is no reliable route to transport to rural regions. We then want to produce and improve enzymes using synthetic biology methods, we turned our attention to LAMP, the simplest enzyme, which amplifies much more efficiently than tHDA, and although its primers are more complex, it also has better reaction specificity, recognizing six nucleic acid fragments specifically.
Table 1. Comparison of LAMP and tHDA[3]
# Build
After bioinformatics analysis of the genome DNA using BLAST and referencing the existing PCR detection method of C. albicans, we targeted the ITS2 region of the 5.8S rDNA of C. albicans, and the primers and probe are as follow:
| Sequenc (5--3) | Type | |
|---|---|---|
| F3 | TGGGTTTGCTTGAAAGACGG | LAMP Primer |
| B3 | CTTCACTCGCCGCTACTG | |
| FIP | CCGCCGCAAGCAATGTTTTTGGTAGTGGTAAGGCGGGATCG | |
| biotin-BIP | ATCAGGTAGGACTACCCGCTGAAGGCAATCCCTGTTGGTTTC | |
| LF | TTGACAATGGCTTAGGTCTA | |
| LB | GCATATCAATAAGCGGAGGA | |
| FITC-probe | ATTGCTTGCGGCGGTAACGTCC | LFA Probe |
The LAMP primer sets were designed using Primer Explorer Ver. 4 (http://primerexplorer.jp/e/). For lateral flow assay (LF) Assay detection, one detection probe was tagged with biotin at the 5' end, which has been entailed in the primer, and the other with FITC at the 3' end. The newly designed probes were screened using the oligoanalyzer and BLAST tool ( http://www.ncbi.nlm.nih.gov/BLAST).
# Test
Eventually, we switched to LAMP for the isothermal amplification reaction and obtained positive results with better specificity and stronger signal.
Figure 11. A successful test of LAMP combined with LFA. M: DL2000 marker, The brightest band of 750 bp was about 100 ng and other
bands about 50 ng. N: negative control, using genomic DNA of S. cerevisiae as the sample); C: positive amplification of the genomic DNA of C. alibicans, which displayed a red line at the appropriate
position on LFA testing strip.
# Reference
[1]. Sathiamoorthy S, Shin JA. Boundaries of the origin of replication: creation of a pET-28a-derived vector with p15A copy control allowing compatible coexistence with pET vectors. PLoS One. 2012;7(10):e47259. doi:10.1371/journal.pone.0047259
[2]. Guzman LM, Belin D, Carson MJ, Beckwith J. Tight regulation, modulation, and high-level expression by vectors containing the arabinose PBAD promoter. J Bacteriol. 1995;177(14):4121-4130. doi:10.1128/jb.177.14.4121-4130.1995
[3]. Zhao, Y., Chen, F., Li, Q., Wang, L., & Fan, C. (2015). Isothermal Amplification of Nucleic Acids. Chemical reviews, 115(22), 12491–12545.