Team:Manchester/Wet-lab-results
Building and Testing Biosensors for Urea and Sarcosine
Overview
- For our kill switch to function we require biosensors responding to two metabolites that are commonly found in urine: urea and sarcosine
- We designed and built biosensors for urea and sarcosine and tested them for their range of detection in Escherichia coli
- SouR/PglyA1 responded to sarcosine at concentrations above 12.5 mM; to our knowledge, this is the first time a biosensor for sarcosine has been reported
- Unfortunately, UreR/PureD did not respond to urea under our conditions tested
- We briefly discuss strategies to improve these sensors for future application in our kill switch
- The UreR/PureD-urea sensor did not mediate controllable gene expression in response to urea. This observation is in disagreement with previous findings that expression from PureD can be fine-tuned for urea concentrations up to 10 mM (2). Expression of the regulator UreR might need to be adjusted for UreR/PureD to mediate an inducible gene expression. Another explanation might be that under our conditions tested urea might be present within the cell at concentrations high enough to saturate expression from PureD (3).
- The SouR/PglyA1-sarcosine sensor mediated controllable gene expression upon supplementation with sarcosine above 25 mM. However, for the sensor to be used within our kill switch design, it would be required to respond to μM concentrations of sarcosine to mimic the conditions of the urinary tract. Protein engineering could be performed on SouR aiming at increasing its sensitivity for sarcosine.
- Lee, Taek Soon, Rachel A. Krupa, Fuzhong Zhang, Meghdad Hajimorad, William J. Holtz, Nilu Prasad, Sung Kuk Lee, and Jay D. Keasling. "BglBrick vectors and datasheets: a synthetic biology platform for gene expression." Journal of biological engineering 5, no. 1 (2011): 1-14.
- D'Orazio, S. E., Thomas, V., & Collins, C. M. (1996). Activation of transcription at divergent urea‐dependent promoters by the urease gene regulator UreR. Molecular microbiology, 21(3), 643-655.
- Morris, D. R., & Koffron, K. L. (1967). Urea production and putrescine biosynthesis by Escherichia coli. Journal of bacteriology, 94(5), 1516-1519.
Design
The designs of our urea and sarcosine biosensors are described under Safety. Regulators were optimised for E. coli codon usage and sequences were designed to contain AatII and NdeI restriction sites, enabling restriction enzyme-based cloning into BglBrick vector pBbE8c-rfp (Figure 1; (1)). DNA sequences were synthesised by Integrated DNA Technologies (IDT).
Figure 1.- Schematic illustration of the genetic features within the putative UreR/PureD-urea- (top) and SouR/PglyA1-sarcosine-inducible systems (bottom) linked to the mrfp1 reporter gene. Inducible systems were flanked by AatII/NdeI restriction sites to facilitate restriction enzyme-based cloning.
Build
Urea- and sarcosine-biosensors were amplified by PCR using oligonucleotide primers listed in Table 1 and cloned into pBbE8c-rfp as described in protocols.
Table 1.- Oligonucleotide primers used to amplify the urea- and sarcosine-inducible systems. Restriction sites used for cloning are underlined.
| Primer | Primer sequence (5’ to 3’) | Template | Used to clone |
|---|---|---|---|
| ureR_f | ccagatatcgacgtctcactcgtcaatttcc | Synthesised |
pBbEureR-PureD-rfp (BBa_K3710004) |
| ureR_r | gctactcgccatatgttctcctgcaactcagtc | ||
| souR_f | ccagatatcgacgtctcactttgtcgaac | Synthesised |
pBbEsouR-PglyA1-rfp (BBa_K3710005) |
| souR_r | gctactcgccatatgtgggtctccctgcg |
Following transformation in E. coli DH5a, to confirm correct assembly of plasmids, two colonies per sensor were picked. The plasmids were extracted and digested using AatII/NdeI. The expected sizes are summarised in Table 2.
Table 2.- Expected sizes of fragments after digest of the urea- and sarcosine-sensor plasmids using AatII and NdeI. pBbE8c-rfp, harbouring the arabinose-inducible system, was used as control.
| Plasmid | Expected sizes (bp) | Lane(s) on agarose gel (Figure 2) | ||
|---|---|---|---|---|
| pBbEureR-PureD-rfp | 2565, 1305 | 1, 2 | ||
| pBbEsouR-PglyA1-rfp | 2565, 1320 | 3, 4 | ||
| pBbE8c-rfp | 2565, 1239 | 5 |
The diagnostic digest showed that the smaller fragments of the urea- and sarcosine sensors are slightly larger than the one from pBbE8c-rfp, suggesting that the arabinose-inducible system has been successfully replaced by the urea- and sarcosine-inducible systems (Figure 2). Subsequently, DNA sequences of the urea- and sarcosine sensors, corresponding to lane 1 and 3 on the gel in Figure 2, were validated by Sanger sequencing.
Figure 2.- Diagnostic digest of assembled urea- and sarcosine biosensors. Plasmids were digested using AatII/NdeI restriction enzymes. Lanes 1 and 2 correspond to the constructed urea sensor. Lanes 3 and 4 correspond to the constructed sarcosine sensor. Lane 5 corresponds to AatII/NdeI-digested pBbE8c-rfp.
Test
To determine the range of detection of both the urea- and sarcosine-sensors, E. coli carrying the sensors were grown in minimal media and left untreated or supplemented with their respective inducers at final concentrations ranging from 0.2 to 100 mM. Fluorescence and absorbance were quantified every 5 min for 16 hours (see protocol).
First, we evaluated whether supplementation of the growth media with urea and sarcosine had any effects on cell viability. Lower concentrations of up to 25 mM of both urea and sarcosine had a growth-promoting effect on E. coli especially during later growth stages (Figure 3), whereas urea concentrations of 50 mM and more had a slightly negative effect on growth with up to 20% reduced cell viability.
Figure 3.- Growth of E. coli carrying urea (left) and sarcosine (right) biosensors with increasing concentrations of urea and sarcosine, measured at 0, 7, 9, 12h (urea) and 0, 3, 6, 9h (sarcosine)
The promoter output in response to a range of different urea and sarcosine concentrations was quantified for cells in the exponential growth phase and normalised by culture absorbance. As cells carrying the urea sensor demonstrated a significant lag in growth, the dose-responses for the urea- and sarcosine sensors are shown at two different time points, at 9 and 6 hours, respectively (Figure 4).
Figure 4.- Dose-responses of E. coli carrying the urea- (left) and sarcosine-sensors (right) at different concentrations of their respective inducers 9 and 6 hours after inducer addition, respectively.
The urea sensor did not show an increase in reporter gene expression upon supplementation with increasing concentrations of urea. In fact, fluorescence levels slightly dropped at higher urea concentrations. In contrast to the sarcosine sensor, however, absolute fluorescence levels are high.
The sarcosine sensor showed an increase in RFP fluorescence with increasing concentration of sarcosine. In the absence of inducer, fluorescence was at the level of media autofluorescence, indicating a tight repression of the glyA1 promoter by SouR. The minimum concentration of sarcosine that mediated an activation of reporter was 25 mM.
Learn